Incidental Mutation 'R5497:Map2k4'
ID432429
Institutional Source Beutler Lab
Gene Symbol Map2k4
Ensembl Gene ENSMUSG00000033352
Gene Namemitogen-activated protein kinase kinase 4
SynonymsSerk1, MKK4, Sek1, JNKK1
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65688243-65788297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65735205 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 136 (I136T)
Ref Sequence ENSEMBL: ENSMUSP00000114219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046963] [ENSMUST00000130009] [ENSMUST00000138093] [ENSMUST00000140301] [ENSMUST00000152096]
Predicted Effect probably benign
Transcript: ENSMUST00000046963
AA Change: I125T

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041282
Gene: ENSMUSG00000033352
AA Change: I125T

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
S_TKc 100 365 9.38e-79 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000103261
Predicted Effect probably benign
Transcript: ENSMUST00000130009
SMART Domains Protein: ENSMUSP00000137819
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138093
AA Change: I9T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000140301
SMART Domains Protein: ENSMUSP00000137955
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152096
AA Change: I136T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114219
Gene: ENSMUSG00000033352
AA Change: I136T

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Pfam:Pkinase_Tyr 111 202 2.5e-9 PFAM
Pfam:Pkinase 111 204 1e-13 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase (MAPK) family. Members of this family act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. They form a three-tiered signaling module composed of MAPKKKs, MAPKKs, and MAPKs. This protein is phosphorylated at serine and threonine residues by MAPKKKs and subsequently phosphorylates downstream MAPK targets at threonine and tyrosine residues. A similar protein in mouse has been reported to play a role in liver organogenesis. A pseudogene of this gene is located on the long arm of chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal liver development with a deficiency of parenchymal hepatocytes, severe anemia, and lethality before embryonic day 14.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Map2k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Map2k4 APN 11 65719479 splice site probably benign
IGL01318:Map2k4 APN 11 65756263 splice site probably benign
IGL02500:Map2k4 APN 11 65696310 missense probably damaging 1.00
IGL02628:Map2k4 APN 11 65690741 missense possibly damaging 0.83
IGL02873:Map2k4 APN 11 65719574 missense probably damaging 0.97
IGL03124:Map2k4 APN 11 65690791 missense probably damaging 0.98
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0646:Map2k4 UTSW 11 65712275 missense probably damaging 1.00
R2073:Map2k4 UTSW 11 65693456 missense probably damaging 0.99
R2931:Map2k4 UTSW 11 65756337 missense probably damaging 0.99
R3800:Map2k4 UTSW 11 65690781 nonsense probably null
R4820:Map2k4 UTSW 11 65696375 splice site probably benign
R4913:Map2k4 UTSW 11 65709932 missense probably damaging 1.00
R5452:Map2k4 UTSW 11 65719587 missense probably damaging 0.97
R5812:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5976:Map2k4 UTSW 11 65709952 missense probably benign 0.31
R6282:Map2k4 UTSW 11 65707016 missense possibly damaging 0.78
R6505:Map2k4 UTSW 11 65693529 missense possibly damaging 0.63
R6784:Map2k4 UTSW 11 65691751 unclassified probably benign
R7560:Map2k4 UTSW 11 65775757 missense unknown
R8071:Map2k4 UTSW 11 65707001 missense
Predicted Primers PCR Primer
(F):5'- GGGGCCAGAAGTTTAAAACCTG -3'
(R):5'- CACACGTACTCAGTGCTAGC -3'

Sequencing Primer
(F):5'- GGCCAGAAGTTTAAAACCTGTTAATG -3'
(R):5'- ACGTACTCAGTGCTAGCTAAAAG -3'
Posted On2016-10-05