Incidental Mutation 'R5497:Cebpe'
ID432440
Institutional Source Beutler Lab
Gene Symbol Cebpe
Ensembl Gene ENSMUSG00000052435
Gene NameCCAAT/enhancer binding protein (C/EBP), epsilon
SynonymsCRP1, C/EBPepsilon, LOC239097, C/EBPe
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #R5497 (G1)
Quality Score152
Status Not validated
Chromosome14
Chromosomal Location54710360-54712174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54710595 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 264 (F264L)
Ref Sequence ENSEMBL: ENSMUSP00000068927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064290]
Predicted Effect probably benign
Transcript: ENSMUST00000064290
AA Change: F264L

PolyPhen 2 Score 0.389 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000068927
Gene: ENSMUSG00000052435
AA Change: F264L

DomainStartEndE-ValueType
PDB:3T92|A 37 61 8e-8 PDB
low complexity region 165 190 N/A INTRINSIC
BRLZ 202 266 4e-17 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bZIP transcription factor which can bind as a homodimer to certain DNA regulatory regions. It can also form heterodimers with the related protein CEBP-delta. The encoded protein may be essential for terminal differentiation and functional maturation of committed granulocyte progenitor cells. Mutations in this gene have been associated with Specific Granule Deficiency, a rare congenital disorder. Multiple variants of this gene have been described, but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired neutrophil and eosinophil development and myelodysplasia. Mutant animals are susceptible to secondary bacterial infections such as conjuntivitis, rhinitis, and pneumonia, and become moribund between 2-5 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Eif3e T C 15: 43,270,970 Y127C probably damaging Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Cebpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Cebpe APN 14 54711613 missense probably damaging 1.00
IGL02618:Cebpe APN 14 54710777 missense probably damaging 1.00
R0071:Cebpe UTSW 14 54710604 missense probably damaging 1.00
R0071:Cebpe UTSW 14 54710604 missense probably damaging 1.00
R1740:Cebpe UTSW 14 54711942 missense probably damaging 1.00
R1742:Cebpe UTSW 14 54711600 missense probably benign 0.19
R7094:Cebpe UTSW 14 54710603 missense probably damaging 1.00
R7505:Cebpe UTSW 14 54710656 missense probably damaging 1.00
R7592:Cebpe UTSW 14 54711841 missense probably damaging 0.99
Z1177:Cebpe UTSW 14 54710580 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTGCAGTTTATTCAGCCACAG -3'
(R):5'- AGATAGCCTGGAGTACCGAC -3'

Sequencing Primer
(F):5'- TCAGCCACAGAATCATTTGGTC -3'
(R):5'- AGTACCGACTGCGACGTGAAC -3'
Posted On2016-10-05