Incidental Mutation 'R5497:Eif3e'
ID432441
Institutional Source Beutler Lab
Gene Symbol Eif3e
Ensembl Gene ENSMUSG00000022336
Gene Nameeukaryotic translation initiation factor 3, subunit E
SynonymsEif3s6, eIF3-p46, 48kDa, Int6, eIF3-p48
MMRRC Submission 043058-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R5497 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location43250058-43282719 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43270970 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 127 (Y127C)
Ref Sequence ENSEMBL: ENSMUSP00000022960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022960]
Predicted Effect probably damaging
Transcript: ENSMUST00000022960
AA Change: Y127C

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022960
Gene: ENSMUSG00000022336
AA Change: Y127C

DomainStartEndE-ValueType
eIF3_N 5 138 4.88e-70 SMART
Blast:eIF3_N 157 193 2e-14 BLAST
Blast:PINT 218 251 7e-9 BLAST
Blast:PINT 284 315 3e-13 BLAST
PINT 327 411 8.17e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226281
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228892
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.3%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik A T 11: 72,165,534 M800K probably benign Het
Abca9 G A 11: 110,130,692 A1064V probably damaging Het
Acsm2 A T 7: 119,573,320 T129S possibly damaging Het
Adamts9 A T 6: 92,854,365 C755S probably damaging Het
Adarb1 T C 10: 77,325,889 D2G probably damaging Het
Apaf1 G A 10: 90,999,656 A1098V probably damaging Het
Asap3 A G 4: 136,239,222 H537R probably benign Het
Atp2a2 C T 5: 122,458,169 C887Y probably damaging Het
Atp6v0a1 G A 11: 101,029,185 V215M probably damaging Het
Cacng8 A G 7: 3,415,553 E407G probably benign Het
Capn8 G A 1: 182,620,180 E535K probably benign Het
Cebpe A G 14: 54,710,595 F264L probably benign Het
Ces1c A C 8: 93,130,715 N79K possibly damaging Het
Cfap58 T G 19: 48,029,109 S803A probably benign Het
Cpa1 A G 6: 30,640,730 T124A probably benign Het
Csmd1 A G 8: 16,085,181 S1654P probably benign Het
Dmbt1 A T 7: 131,063,403 probably benign Het
Fam160b1 G C 19: 57,381,151 probably null Het
Galnt5 T C 2: 58,025,328 M632T probably damaging Het
Gja8 A G 3: 96,920,197 S50P probably damaging Het
Gon7 A G 12: 102,754,104 S90P probably benign Het
Gucy2g C T 19: 55,198,701 V1096I probably benign Het
Gxylt2 A G 6: 100,787,329 N325S probably benign Het
H2-Ob A G 17: 34,241,170 D85G probably benign Het
Heatr1 T A 13: 12,421,064 I1161N possibly damaging Het
Hjurp G A 1: 88,266,320 H289Y possibly damaging Het
Hsd3b7 A G 7: 127,801,888 Y99C probably damaging Het
Ifnar1 T G 16: 91,505,364 Y21D probably benign Het
Isoc2b C T 7: 4,850,783 V131I probably benign Het
Klc3 T C 7: 19,394,670 I500V probably benign Het
Lrp5 C A 19: 3,602,319 G1184W probably damaging Het
Map2k4 A G 11: 65,735,205 I136T probably damaging Het
Map3k7 T C 4: 31,991,719 F319S possibly damaging Het
Muc5ac A G 7: 141,807,643 T1564A probably damaging Het
Nptx2 A T 5: 144,556,189 D362V probably damaging Het
Nutf2-ps1 A T 19: 53,588,834 I52N probably damaging Het
Olfr169 C T 16: 19,566,330 M184I probably benign Het
Pkhd1 T A 1: 20,377,404 Y2255F possibly damaging Het
Primpol A T 8: 46,592,622 Y308* probably null Het
Retreg2 G A 1: 75,144,989 V219I probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rph3a T A 5: 120,942,190 E675V probably benign Het
Ryr2 A T 13: 11,705,701 M2687K probably null Het
Shank2 A G 7: 144,409,534 D293G probably damaging Het
Snx6 A G 12: 54,757,061 V154A probably damaging Het
Srm G T 4: 148,594,109 Q264H probably benign Het
Styk1 A T 6: 131,304,707 I316N probably damaging Het
Syne2 A G 12: 75,880,389 N103S probably benign Het
Tas2r105 G A 6: 131,686,842 probably null Het
Tbcel T A 9: 42,451,745 M1L possibly damaging Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Tm9sf3 T C 19: 41,215,116 S574G probably benign Het
Usp31 A T 7: 121,651,601 V783E probably damaging Het
Vmn2r61 T A 7: 42,275,482 Y487N possibly damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp980 A G 4: 145,701,447 K249E probably damaging Het
Other mutations in Eif3e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Eif3e APN 15 43278349 missense probably benign 0.17
IGL02333:Eif3e APN 15 43266137 missense probably benign 0.37
IGL02669:Eif3e APN 15 43282692 start codon destroyed probably benign
IGL03119:Eif3e APN 15 43265604 missense probably benign
IGL03200:Eif3e APN 15 43252261 missense probably damaging 1.00
Verdugo UTSW 15 43272289 missense probably benign 0.29
R0152:Eif3e UTSW 15 43252236 missense possibly damaging 0.83
R1439:Eif3e UTSW 15 43278428 splice site probably benign
R1613:Eif3e UTSW 15 43250224 missense possibly damaging 0.81
R1997:Eif3e UTSW 15 43265609 missense probably damaging 1.00
R2221:Eif3e UTSW 15 43251547 missense possibly damaging 0.95
R3761:Eif3e UTSW 15 43261084 missense probably damaging 0.99
R4241:Eif3e UTSW 15 43262690 missense probably damaging 0.97
R4571:Eif3e UTSW 15 43266162 missense possibly damaging 0.74
R5061:Eif3e UTSW 15 43252261 missense probably damaging 1.00
R5227:Eif3e UTSW 15 43251521 missense probably benign 0.01
R5367:Eif3e UTSW 15 43252304 missense probably damaging 1.00
R5417:Eif3e UTSW 15 43265521 missense probably benign 0.00
R5928:Eif3e UTSW 15 43275332 synonymous probably null
R6083:Eif3e UTSW 15 43266144 missense probably damaging 1.00
R6337:Eif3e UTSW 15 43252296 missense possibly damaging 0.95
R6964:Eif3e UTSW 15 43272289 missense probably benign 0.29
R7692:Eif3e UTSW 15 43263246 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTTGTTGCAAAGCCACTGC -3'
(R):5'- TGACAGTTCCACGTGTGTG -3'

Sequencing Primer
(F):5'- TCTCCTTTGCAAATGACTGTTG -3'
(R):5'- CCACGTGTGTGTATGTGCAC -3'
Posted On2016-10-05