Mutagenetix > Incidental Mutation

Incidental Mutation 'R5498:Spag17'

432459

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

PF6, 4931427F14Rik

MMRRC Submission

043059-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5498 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

99792722-100050638 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 100010661 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 2052 (A2052T)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

AlphaFold

Q5S003

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137776

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145279

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164539
AA Change: A2052T

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: A2052T

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.8%
20x: 89.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	A	5: 109,885,413 (GRCm39)	K148N	probably benign	Het
Abca6	T	A	11: 110,099,670 (GRCm39)	D959V	possibly damaging	Het
Acot12	T	C	13: 91,929,352 (GRCm39)	V393A	probably damaging	Het
Ano3	C	A	2: 110,527,448 (GRCm39)	V587F	possibly damaging	Het
Bub1	T	C	2: 127,656,629 (GRCm39)	D471G	possibly damaging	Het
Cdh15	G	T	8: 123,591,917 (GRCm39)	V601F	possibly damaging	Het
Cdt1	C	T	8: 123,297,239 (GRCm39)	R311W	probably damaging	Het
Cnot1	A	T	8: 96,483,983 (GRCm39)	I706N	possibly damaging	Het
Fbn1	A	G	2: 125,202,096 (GRCm39)	I1259T	probably damaging	Het
Furin	A	T	7: 80,041,542 (GRCm39)	W539R	probably damaging	Het
Hivep1	A	T	13: 42,276,634 (GRCm39)		probably null	Het
Igkv3-9	A	G	6: 70,565,727 (GRCm39)	M109V	probably benign	Het
Klf10	G	A	15: 38,296,283 (GRCm39)	R421W	probably damaging	Het
Mtor	A	T	4: 148,624,821 (GRCm39)	Y2144F	possibly damaging	Het
Mybpc2	T	C	7: 44,165,689 (GRCm39)	Y297C	probably damaging	Het
Myom2	G	A	8: 15,179,142 (GRCm39)	E1325K	probably benign	Het
Nsd1	A	T	13: 55,361,115 (GRCm39)	K28*	probably null	Het
Or2r11	C	T	6: 42,437,228 (GRCm39)	A242T	probably benign	Het
Or51b4	T	G	7: 103,530,839 (GRCm39)	T204P	probably damaging	Het
Phc2	C	A	4: 128,602,787 (GRCm39)	N120K	probably benign	Het
Pias3	A	G	3: 96,609,504 (GRCm39)	T274A	possibly damaging	Het
Plcb4	T	A	2: 135,818,092 (GRCm39)	I786N	probably damaging	Het
Plec	G	A	15: 76,061,654 (GRCm39)	S2626L	probably damaging	Het
Polg	A	G	7: 79,104,418 (GRCm39)	L819P	probably damaging	Het
Ppp2r3d	T	C	9: 124,439,123 (GRCm38)		probably benign	Het
Resf1	A	G	6: 149,229,738 (GRCm39)	D928G	probably damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Rnpc3	A	G	3: 113,404,856 (GRCm39)		probably null	Het
Sarnp	T	A	10: 128,689,063 (GRCm39)	D65E	probably benign	Het
Sh3bp5	C	A	14: 31,099,452 (GRCm39)	R265L	probably benign	Het
Slc16a10	C	T	10: 39,913,323 (GRCm39)	V462M	probably damaging	Het
Slc45a2	C	T	15: 11,027,871 (GRCm39)	T480I	probably damaging	Het
Slfn5	A	T	11: 82,847,973 (GRCm39)	H286L	possibly damaging	Het
Sptbn5	A	T	2: 119,907,119 (GRCm39)		probably benign	Het
Tlr3	C	T	8: 45,851,851 (GRCm39)	D349N	possibly damaging	Het
Trim45	T	C	3: 100,832,457 (GRCm39)	V230A	possibly damaging	Het
Ube3b	T	C	5: 114,556,635 (GRCm39)	F989L	probably damaging	Het
Vps51	T	G	19: 6,121,063 (GRCm39)	E283D	probably benign	Het
Wdr24	A	G	17: 26,043,535 (GRCm39)	H119R	probably damaging	Het
Yars2	T	A	16: 16,124,387 (GRCm39)	H331Q	possibly damaging	Het
Zscan21	T	C	5: 138,131,522 (GRCm39)	S349P	probably benign	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	99,970,691 (GRCm39)	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99,846,614 (GRCm39)	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100,002,865 (GRCm39)	missense	probably benign	0.16
IGL01393:Spag17	APN	3	99,934,926 (GRCm39)	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100,016,824 (GRCm39)	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	99,930,046 (GRCm39)	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99,847,390 (GRCm39)	splice site	probably benign
IGL01981:Spag17	APN	3	99,966,149 (GRCm39)	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99,889,760 (GRCm39)	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	99,934,707 (GRCm39)	missense	probably benign	0.00
IGL02465:Spag17	APN	3	99,983,187 (GRCm39)	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	99,979,401 (GRCm39)	missense	probably benign	0.09
IGL02751:Spag17	APN	3	99,918,110 (GRCm39)	nonsense	probably null
IGL02803:Spag17	APN	3	100,016,713 (GRCm39)	missense	probably benign
IGL02898:Spag17	APN	3	100,008,702 (GRCm39)	missense	probably benign	0.00
IGL03037:Spag17	APN	3	99,979,486 (GRCm39)	splice site	probably null
IGL03068:Spag17	APN	3	99,987,521 (GRCm39)	missense	probably benign	0.35
IGL03131:Spag17	APN	3	99,918,075 (GRCm39)	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	99,918,156 (GRCm39)	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	99,963,568 (GRCm39)	small insertion	probably benign
FR4342:Spag17	UTSW	3	99,963,565 (GRCm39)	small insertion	probably benign
FR4548:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,574 (GRCm39)	small insertion	probably benign
FR4589:Spag17	UTSW	3	99,963,561 (GRCm39)	small insertion	probably benign
FR4737:Spag17	UTSW	3	99,963,573 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,571 (GRCm39)	small insertion	probably benign
FR4976:Spag17	UTSW	3	99,963,570 (GRCm39)	small insertion	probably benign
N/A:Spag17	UTSW	3	99,889,570 (GRCm39)	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100,010,426 (GRCm39)	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	99,920,527 (GRCm39)	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	99,958,103 (GRCm39)	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100,014,143 (GRCm39)	missense	probably benign	0.08
R0243:Spag17	UTSW	3	99,992,684 (GRCm39)	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100,008,719 (GRCm39)	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R0417:Spag17	UTSW	3	99,972,870 (GRCm39)	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99,889,727 (GRCm39)	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100,032,618 (GRCm39)	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	99,987,472 (GRCm39)	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	99,912,101 (GRCm39)	missense	probably benign
R0919:Spag17	UTSW	3	99,979,259 (GRCm39)	splice site	probably benign
R0926:Spag17	UTSW	3	99,979,432 (GRCm39)	missense	probably benign
R1037:Spag17	UTSW	3	100,010,433 (GRCm39)	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100,000,992 (GRCm39)	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	99,934,667 (GRCm39)	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100,002,954 (GRCm39)	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99,889,584 (GRCm39)	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99,846,679 (GRCm39)	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	99,929,068 (GRCm39)	missense	possibly damaging	0.53
R1768:Spag17	UTSW	3	99,934,668 (GRCm39)	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	99,918,070 (GRCm39)	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99,846,672 (GRCm39)	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99,847,298 (GRCm39)	missense	probably benign
R2065:Spag17	UTSW	3	99,920,524 (GRCm39)	missense	probably benign	0.03
R2118:Spag17	UTSW	3	99,956,556 (GRCm39)	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2266:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2267:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2268:Spag17	UTSW	3	99,969,182 (GRCm39)	splice site	probably null
R2271:Spag17	UTSW	3	100,014,113 (GRCm39)	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100,014,153 (GRCm39)	missense	probably benign	0.27
R2420:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2422:Spag17	UTSW	3	99,934,935 (GRCm39)	missense	probably benign
R2423:Spag17	UTSW	3	100,010,772 (GRCm39)	missense	probably benign
R3407:Spag17	UTSW	3	99,992,615 (GRCm39)	missense	probably benign	0.09
R3801:Spag17	UTSW	3	99,961,169 (GRCm39)	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100,014,075 (GRCm39)	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4022:Spag17	UTSW	3	99,956,546 (GRCm39)	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100,010,694 (GRCm39)	missense	probably benign
R4468:Spag17	UTSW	3	99,992,682 (GRCm39)	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	99,995,697 (GRCm39)	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100,010,559 (GRCm39)	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100,010,701 (GRCm39)	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99,891,795 (GRCm39)	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	99,970,649 (GRCm39)	missense	probably benign	0.02
R4887:Spag17	UTSW	3	99,958,147 (GRCm39)	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	99,934,939 (GRCm39)	missense	probably benign
R5030:Spag17	UTSW	3	99,992,657 (GRCm39)	nonsense	probably null
R5042:Spag17	UTSW	3	99,979,465 (GRCm39)	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100,008,704 (GRCm39)	missense	probably benign	0.16
R5200:Spag17	UTSW	3	99,970,787 (GRCm39)	nonsense	probably null
R5267:Spag17	UTSW	3	99,969,264 (GRCm39)	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100,016,726 (GRCm39)	missense	probably benign	0.00
R5444:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5503:Spag17	UTSW	3	99,934,560 (GRCm39)	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	99,963,588 (GRCm39)	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	99,963,468 (GRCm39)	missense	probably benign	0.06
R5575:Spag17	UTSW	3	99,961,138 (GRCm39)	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	99,987,435 (GRCm39)	missense	probably benign	0.33
R5639:Spag17	UTSW	3	99,963,482 (GRCm39)	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99,846,566 (GRCm39)	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100,003,107 (GRCm39)	nonsense	probably null
R6082:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	99,929,918 (GRCm39)	missense	probably benign	0.33
R6254:Spag17	UTSW	3	99,972,901 (GRCm39)	missense	probably benign	0.03
R6321:Spag17	UTSW	3	99,995,743 (GRCm39)	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100,010,448 (GRCm39)	missense	probably benign
R6687:Spag17	UTSW	3	100,000,266 (GRCm39)	missense	probably benign	0.07
R6853:Spag17	UTSW	3	99,920,551 (GRCm39)	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	99,911,999 (GRCm39)	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	99,942,291 (GRCm39)	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99,891,925 (GRCm39)	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99,846,586 (GRCm39)	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100,008,751 (GRCm39)	missense	probably benign	0.00
R7144:Spag17	UTSW	3	99,934,717 (GRCm39)	splice site	probably null
R7198:Spag17	UTSW	3	100,002,888 (GRCm39)	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99,847,299 (GRCm39)	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99,846,691 (GRCm39)	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	99,934,547 (GRCm39)	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	99,941,475 (GRCm39)	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99,846,563 (GRCm39)	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100,002,911 (GRCm39)	nonsense	probably null
R7772:Spag17	UTSW	3	99,987,434 (GRCm39)	missense	probably damaging	0.98
R7842:Spag17	UTSW	3	99,961,174 (GRCm39)	missense	probably benign	0.18
R7963:Spag17	UTSW	3	99,929,954 (GRCm39)	missense	probably benign	0.02
R8168:Spag17	UTSW	3	99,942,300 (GRCm39)	missense	possibly damaging	0.96
R8291:Spag17	UTSW	3	99,968,166 (GRCm39)	missense	probably benign
R8347:Spag17	UTSW	3	99,934,957 (GRCm39)	missense	probably benign
R8383:Spag17	UTSW	3	99,992,708 (GRCm39)	missense	probably damaging	0.98
R8474:Spag17	UTSW	3	99,934,586 (GRCm39)	missense	probably benign	0.00
R8528:Spag17	UTSW	3	100,031,501 (GRCm39)	missense	possibly damaging	0.46
R8804:Spag17	UTSW	3	99,874,506 (GRCm39)	missense	probably benign
R8809:Spag17	UTSW	3	99,889,738 (GRCm39)	missense	probably benign	0.33
R8818:Spag17	UTSW	3	99,920,543 (GRCm39)	missense	probably benign	0.02
R8830:Spag17	UTSW	3	100,032,751 (GRCm39)	missense	possibly damaging	0.77
R8890:Spag17	UTSW	3	99,911,994 (GRCm39)	missense	possibly damaging	0.73
R9008:Spag17	UTSW	3	99,934,942 (GRCm39)	missense	possibly damaging	0.73
R9095:Spag17	UTSW	3	99,912,092 (GRCm39)	missense	possibly damaging	0.86
R9143:Spag17	UTSW	3	99,934,906 (GRCm39)	missense	probably benign
R9182:Spag17	UTSW	3	99,966,158 (GRCm39)	missense	possibly damaging	0.92
R9211:Spag17	UTSW	3	100,032,614 (GRCm39)	critical splice acceptor site	probably benign
R9344:Spag17	UTSW	3	100,010,793 (GRCm39)	missense	probably benign	0.01
R9354:Spag17	UTSW	3	99,934,905 (GRCm39)	missense	probably benign
R9527:Spag17	UTSW	3	99,970,777 (GRCm39)	missense	probably damaging	1.00
R9658:Spag17	UTSW	3	99,934,932 (GRCm39)	missense	possibly damaging	0.93
R9738:Spag17	UTSW	3	99,934,526 (GRCm39)	missense	possibly damaging	0.53
X0025:Spag17	UTSW	3	100,008,767 (GRCm39)	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100,002,946 (GRCm39)	missense	probably benign	0.09
Z1176:Spag17	UTSW	3	99,920,309 (GRCm39)	missense	probably benign	0.18
Z1177:Spag17	UTSW	3	99,995,715 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GATTCTACACTGACCGTAGATACAG -3'
(R):5'- TTTGAACCTGTGAGATAAAGAGAGC -3'

Sequencing Primer
(F):5'- TACACTGACCGTAGATACAGAAAAAG -3'
(R):5'- CCTGTGAGATAAAGAGAGCAAACTAC -3'

Posted On

2016-10-05