Mutagenetix > Incidental Mutations

Incidental Mutation 'R5498:Cnot1'

432476

Institutional Source

Beutler Lab

Gene Symbol

Cnot1

Ensembl Gene

ENSMUSG00000036550

Gene Name

CCR4-NOT transcription complex, subunit 1

Synonyms

6030411K04Rik

MMRRC Submission

043059-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5498 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

95719451-95807464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 95757355 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 706 (I706N)

Ref Sequence

ENSEMBL: ENSMUSP00000148735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]

Predicted Effect

probably benign
Transcript: ENSMUST00000068452
AA Change: I706N

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: I706N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
PDB:4J8S\|A	798	999	1e-137	PDB
low complexity region	1011	1028	N/A	INTRINSIC
low complexity region	1031	1055	N/A	INTRINSIC
PDB:4CT4\|C	1056	1295	1e-148	PDB
low complexity region	1296	1308	N/A	INTRINSIC
low complexity region	1328	1345	N/A	INTRINSIC
Pfam:DUF3819	1381	1530	2.5e-56	PFAM
low complexity region	1634	1648	N/A	INTRINSIC
Pfam:Not1	1991	2305	2.4e-125	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083277

Predicted Effect

probably benign
Transcript: ENSMUST00000098473
AA Change: I706N

PolyPhen 2 Score 0.135 (Sensitivity: 0.92; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: I706N

Domain	Start	End	E-Value	Type
low complexity region	181	189	N/A	INTRINSIC
Pfam:CNOT1_HEAT	500	656	2.4e-57	PFAM
low complexity region	687	698	N/A	INTRINSIC
low complexity region	779	796	N/A	INTRINSIC
Pfam:CNOT1_TTP_bind	812	1004	1.4e-87	PFAM
low complexity region	1016	1033	N/A	INTRINSIC
low complexity region	1036	1060	N/A	INTRINSIC
Pfam:CNOT1_CAF1_bind	1087	1313	5.7e-99	PFAM
low complexity region	1333	1350	N/A	INTRINSIC
Pfam:DUF3819	1387	1534	2.3e-57	PFAM
low complexity region	1639	1653	N/A	INTRINSIC
Pfam:Not1	1998	2357	5.7e-157	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000196326

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197815

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211887
AA Change: I704N

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211937

Predicted Effect

unknown
Transcript: ENSMUST00000211973
AA Change: I174N

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212228

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213006
AA Change: I706N

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000213046

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.8%
20x: 89.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	G	6: 149,328,240	D928G	probably damaging	Het
4930522L14Rik	T	A	5: 109,737,547	K148N	probably benign	Het
Abca6	T	A	11: 110,208,844	D959V	possibly damaging	Het
Acot12	T	C	13: 91,781,233	V393A	probably damaging	Het
Ano3	C	A	2: 110,697,103	V587F	possibly damaging	Het
Bub1	T	C	2: 127,814,709	D471G	possibly damaging	Het
Cdh15	G	T	8: 122,865,178	V601F	possibly damaging	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Fbn1	A	G	2: 125,360,176	I1259T	probably damaging	Het
Furin	A	T	7: 80,391,794	W539R	probably damaging	Het
Hivep1	A	T	13: 42,123,158		probably null	Het
Igkv3-9	A	G	6: 70,588,743	M109V	probably benign	Het
Klf10	G	A	15: 38,296,039	R421W	probably damaging	Het
Mtor	A	T	4: 148,540,364	Y2144F	possibly damaging	Het
Mybpc2	T	C	7: 44,516,265	Y297C	probably damaging	Het
Myom2	G	A	8: 15,129,142	E1325K	probably benign	Het
Nsd1	A	T	13: 55,213,302	K28*	probably null	Het
Olfr458	C	T	6: 42,460,294	A242T	probably benign	Het
Olfr66	T	G	7: 103,881,632	T204P	probably damaging	Het
Phc2	C	A	4: 128,708,994	N120K	probably benign	Het
Pias3	A	G	3: 96,702,188	T274A	possibly damaging	Het
Plcb4	T	A	2: 135,976,172	I786N	probably damaging	Het
Plec	G	A	15: 76,177,454	S2626L	probably damaging	Het
Polg	A	G	7: 79,454,670	L819P	probably damaging	Het
Ppp2r3d	T	C	9: 124,439,123		probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rnpc3	A	G	3: 113,611,207		probably null	Het
Sarnp	T	A	10: 128,853,194	D65E	probably benign	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc16a10	C	T	10: 40,037,327	V462M	probably damaging	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slfn5	A	T	11: 82,957,147	H286L	possibly damaging	Het
Spag17	G	A	3: 100,103,345	A2052T	possibly damaging	Het
Sptbn5	A	T	2: 120,076,638		probably benign	Het
Tlr3	C	T	8: 45,398,814	D349N	possibly damaging	Het
Trim45	T	C	3: 100,925,141	V230A	possibly damaging	Het
Ube3b	T	C	5: 114,418,574	F989L	probably damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wdr24	A	G	17: 25,824,561	H119R	probably damaging	Het
Yars2	T	A	16: 16,306,523	H331Q	possibly damaging	Het
Zscan21	T	C	5: 138,133,260	S349P	probably benign	Het

Other mutations in Cnot1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Cnot1	APN	8	95726079	missense	probably damaging	1.00
IGL01340:Cnot1	APN	8	95760537	missense	probably damaging	1.00
IGL01457:Cnot1	APN	8	95741009	missense	probably damaging	1.00
IGL01505:Cnot1	APN	8	95728718	missense	probably damaging	0.98
IGL02401:Cnot1	APN	8	95756133	missense	possibly damaging	0.95
IGL02693:Cnot1	APN	8	95773485	missense	probably damaging	1.00
IGL02696:Cnot1	APN	8	95745017	missense	probably benign	0.00
IGL02754:Cnot1	APN	8	95755078	missense	probably benign	0.03
IGL03092:Cnot1	APN	8	95769615	intron	probably benign
IGL03174:Cnot1	APN	8	95761355	missense	probably damaging	1.00
IGL03310:Cnot1	APN	8	95735680	splice site	probably benign
IGL03371:Cnot1	APN	8	95774716	missense	possibly damaging	0.85
barge	UTSW	8	95734129	missense	probably benign	0.13
tugboat	UTSW	8	95773618	missense	probably damaging	0.99
Xiao	UTSW	8	95730420	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0008:Cnot1	UTSW	8	95761341	missense	probably damaging	1.00
R0091:Cnot1	UTSW	8	95763144	missense	probably damaging	1.00
R0335:Cnot1	UTSW	8	95772000	missense	probably benign	0.02
R0409:Cnot1	UTSW	8	95748855	missense	probably damaging	0.96
R0445:Cnot1	UTSW	8	95760208	missense	probably damaging	1.00
R1505:Cnot1	UTSW	8	95728667	missense	probably damaging	1.00
R1517:Cnot1	UTSW	8	95743213	missense	probably benign	0.38
R1640:Cnot1	UTSW	8	95769832	missense	probably damaging	0.98
R1737:Cnot1	UTSW	8	95748276	missense	probably damaging	0.98
R1755:Cnot1	UTSW	8	95724577	missense	probably damaging	1.00
R1901:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1902:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1903:Cnot1	UTSW	8	95743121	missense	possibly damaging	0.50
R1988:Cnot1	UTSW	8	95741944	missense	possibly damaging	0.89
R2051:Cnot1	UTSW	8	95724593	missense	possibly damaging	0.47
R2054:Cnot1	UTSW	8	95739841	missense	possibly damaging	0.55
R2072:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2074:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2075:Cnot1	UTSW	8	95739833	missense	possibly damaging	0.89
R2093:Cnot1	UTSW	8	95775358	missense	probably damaging	1.00
R2116:Cnot1	UTSW	8	95726153	missense	probably damaging	1.00
R2191:Cnot1	UTSW	8	95761426	missense	probably damaging	0.98
R2238:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2239:Cnot1	UTSW	8	95769521	missense	probably benign	0.04
R2251:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2252:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2253:Cnot1	UTSW	8	95763186	missense	probably benign	0.00
R2315:Cnot1	UTSW	8	95749062	missense	probably damaging	1.00
R2431:Cnot1	UTSW	8	95774652	missense	probably damaging	1.00
R2988:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R2989:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3108:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3109:Cnot1	UTSW	8	95735749	missense	probably damaging	0.99
R3114:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3115:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3153:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R3154:Cnot1	UTSW	8	95744278	missense	possibly damaging	0.80
R4112:Cnot1	UTSW	8	95773618	missense	probably damaging	0.99
R4359:Cnot1	UTSW	8	95739848	missense	probably damaging	1.00
R4382:Cnot1	UTSW	8	95769779	missense	probably damaging	0.97
R4747:Cnot1	UTSW	8	95774682	missense	probably benign	0.27
R4910:Cnot1	UTSW	8	95733231	missense	probably benign	0.43
R4913:Cnot1	UTSW	8	95763067	missense	possibly damaging	0.63
R4971:Cnot1	UTSW	8	95721626	missense	probably damaging	1.00
R5056:Cnot1	UTSW	8	95741008	missense	probably damaging	1.00
R5092:Cnot1	UTSW	8	95752768	missense	possibly damaging	0.91
R5101:Cnot1	UTSW	8	95760187	missense	possibly damaging	0.90
R5719:Cnot1	UTSW	8	95744296	missense	possibly damaging	0.92
R5850:Cnot1	UTSW	8	95734147	nonsense	probably null
R5956:Cnot1	UTSW	8	95754978	critical splice donor site	probably null
R5981:Cnot1	UTSW	8	95788665	missense	probably damaging	1.00
R6093:Cnot1	UTSW	8	95748894	missense	probably benign	0.03
R6108:Cnot1	UTSW	8	95730420	missense	probably damaging	1.00
R6261:Cnot1	UTSW	8	95741921	missense	probably benign	0.00
R6632:Cnot1	UTSW	8	95773267	intron	probably benign
R6882:Cnot1	UTSW	8	95720426	missense	possibly damaging	0.85
R6966:Cnot1	UTSW	8	95724532	missense	probably damaging	1.00
R6985:Cnot1	UTSW	8	95734129	missense	probably benign	0.13
R7210:Cnot1	UTSW	8	95788658	missense	probably damaging	1.00
R7410:Cnot1	UTSW	8	95733159	missense	possibly damaging	0.77
R7623:Cnot1	UTSW	8	95727648	missense	probably damaging	1.00
R7624:Cnot1	UTSW	8	95751819	missense	probably damaging	1.00
R7695:Cnot1	UTSW	8	95770632	missense	probably benign	0.03
R7703:Cnot1	UTSW	8	95760098	critical splice donor site	probably null
R7771:Cnot1	UTSW	8	95765125	missense	probably damaging	0.99
R7800:Cnot1	UTSW	8	95765062	missense	probably benign	0.15
R7809:Cnot1	UTSW	8	95751778	missense	probably damaging	1.00
X0050:Cnot1	UTSW	8	95743098	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- GCAGTGCTTAGTCTCCCAAGAG -3'
(R):5'- TTAGGCATTCTGGGAAATAGCAAG -3'

Sequencing Primer
(F):5'- GTGCTTAGTCTCCCAAGAGTGTAAC -3'
(R):5'- CTGGGAAATAGCAAGTATATCTCAC -3'

Posted On

2016-10-05