Mutagenetix > Incidental Mutation

Incidental Mutation 'R5498:Cdh15'

432478

Institutional Source

Beutler Lab

Gene Symbol

Cdh15

Ensembl Gene

ENSMUSG00000031962

Gene Name

cadherin 15

Synonyms

M cadherin, Mcad, Cdh14

MMRRC Submission

043059-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5498 (G1)

Quality Score

220

Status

Not validated

Chromosome

Chromosomal Location

123575113-123594136 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 123591917 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 601 (V601F)

Ref Sequence

ENSEMBL: ENSMUSP00000034443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]

AlphaFold

P33146

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034443
AA Change: V601F

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: V601F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	64	149	5.95e-18	SMART
CA	173	257	3.09e-25	SMART
CA	280	373	2.5e-11	SMART
CA	396	480	3.45e-14	SMART
Pfam:Cadherin	486	579	5.2e-9	PFAM
transmembrane domain	603	625	N/A	INTRINSIC
Pfam:Cadherin_C	633	783	6.7e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000127664

SMART Domains

Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

Domain	Start	End	E-Value	Type
Pfam:Glycos_transf_2	104	287	7.4e-31	PFAM
Pfam:Glyco_transf_7C	261	331	4.9e-8	PFAM
RICIN	406	531	9.28e-27	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211940

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.8%
20x: 89.2%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	T	A	5: 109,885,413 (GRCm39)	K148N	probably benign	Het
Abca6	T	A	11: 110,099,670 (GRCm39)	D959V	possibly damaging	Het
Acot12	T	C	13: 91,929,352 (GRCm39)	V393A	probably damaging	Het
Ano3	C	A	2: 110,527,448 (GRCm39)	V587F	possibly damaging	Het
Bub1	T	C	2: 127,656,629 (GRCm39)	D471G	possibly damaging	Het
Cdt1	C	T	8: 123,297,239 (GRCm39)	R311W	probably damaging	Het
Cnot1	A	T	8: 96,483,983 (GRCm39)	I706N	possibly damaging	Het
Fbn1	A	G	2: 125,202,096 (GRCm39)	I1259T	probably damaging	Het
Furin	A	T	7: 80,041,542 (GRCm39)	W539R	probably damaging	Het
Hivep1	A	T	13: 42,276,634 (GRCm39)		probably null	Het
Igkv3-9	A	G	6: 70,565,727 (GRCm39)	M109V	probably benign	Het
Klf10	G	A	15: 38,296,283 (GRCm39)	R421W	probably damaging	Het
Mtor	A	T	4: 148,624,821 (GRCm39)	Y2144F	possibly damaging	Het
Mybpc2	T	C	7: 44,165,689 (GRCm39)	Y297C	probably damaging	Het
Myom2	G	A	8: 15,179,142 (GRCm39)	E1325K	probably benign	Het
Nsd1	A	T	13: 55,361,115 (GRCm39)	K28*	probably null	Het
Or2r11	C	T	6: 42,437,228 (GRCm39)	A242T	probably benign	Het
Or51b4	T	G	7: 103,530,839 (GRCm39)	T204P	probably damaging	Het
Phc2	C	A	4: 128,602,787 (GRCm39)	N120K	probably benign	Het
Pias3	A	G	3: 96,609,504 (GRCm39)	T274A	possibly damaging	Het
Plcb4	T	A	2: 135,818,092 (GRCm39)	I786N	probably damaging	Het
Plec	G	A	15: 76,061,654 (GRCm39)	S2626L	probably damaging	Het
Polg	A	G	7: 79,104,418 (GRCm39)	L819P	probably damaging	Het
Ppp2r3d	T	C	9: 124,439,123 (GRCm38)		probably benign	Het
Resf1	A	G	6: 149,229,738 (GRCm39)	D928G	probably damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Rnpc3	A	G	3: 113,404,856 (GRCm39)		probably null	Het
Sarnp	T	A	10: 128,689,063 (GRCm39)	D65E	probably benign	Het
Sh3bp5	C	A	14: 31,099,452 (GRCm39)	R265L	probably benign	Het
Slc16a10	C	T	10: 39,913,323 (GRCm39)	V462M	probably damaging	Het
Slc45a2	C	T	15: 11,027,871 (GRCm39)	T480I	probably damaging	Het
Slfn5	A	T	11: 82,847,973 (GRCm39)	H286L	possibly damaging	Het
Spag17	G	A	3: 100,010,661 (GRCm39)	A2052T	possibly damaging	Het
Sptbn5	A	T	2: 119,907,119 (GRCm39)		probably benign	Het
Tlr3	C	T	8: 45,851,851 (GRCm39)	D349N	possibly damaging	Het
Trim45	T	C	3: 100,832,457 (GRCm39)	V230A	possibly damaging	Het
Ube3b	T	C	5: 114,556,635 (GRCm39)	F989L	probably damaging	Het
Vps51	T	G	19: 6,121,063 (GRCm39)	E283D	probably benign	Het
Wdr24	A	G	17: 26,043,535 (GRCm39)	H119R	probably damaging	Het
Yars2	T	A	16: 16,124,387 (GRCm39)	H331Q	possibly damaging	Het
Zscan21	T	C	5: 138,131,522 (GRCm39)	S349P	probably benign	Het

Other mutations in Cdh15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01329:Cdh15	APN	8	123,592,062 (GRCm39)	intron	probably benign
IGL01958:Cdh15	APN	8	123,586,089 (GRCm39)	missense	probably damaging	1.00
IGL02588:Cdh15	APN	8	123,583,291 (GRCm39)	nonsense	probably null
IGL02793:Cdh15	APN	8	123,587,721 (GRCm39)	missense	probably damaging	1.00
IGL02947:Cdh15	APN	8	123,592,111 (GRCm39)	missense	probably benign	0.00
R0310:Cdh15	UTSW	8	123,592,175 (GRCm39)	missense	probably damaging	1.00
R0441:Cdh15	UTSW	8	123,587,705 (GRCm39)	missense	probably damaging	1.00
R0766:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R0898:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1023:Cdh15	UTSW	8	123,591,939 (GRCm39)	missense	probably damaging	0.98
R1054:Cdh15	UTSW	8	123,591,076 (GRCm39)	missense	possibly damaging	0.85
R1072:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R1081:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1101:Cdh15	UTSW	8	123,587,585 (GRCm39)	missense	possibly damaging	0.93
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1208:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1209:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1210:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1312:Cdh15	UTSW	8	123,588,188 (GRCm39)	intron	probably benign
R1317:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1318:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1393:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1428:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1429:Cdh15	UTSW	8	123,584,234 (GRCm39)	missense	probably damaging	1.00
R1695:Cdh15	UTSW	8	123,588,755 (GRCm39)	missense	probably benign	0.05
R2157:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2170:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2178:Cdh15	UTSW	8	123,591,715 (GRCm39)	splice site	probably null
R2252:Cdh15	UTSW	8	123,584,161 (GRCm39)	missense	probably damaging	1.00
R2290:Cdh15	UTSW	8	123,586,056 (GRCm39)	missense	probably damaging	1.00
R2317:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2330:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2345:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2349:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2353:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2354:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2566:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2567:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2568:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2893:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2894:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R2937:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2938:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2990:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2992:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R2993:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3029:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3030:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3195:Cdh15	UTSW	8	123,583,374 (GRCm39)	missense	probably benign	0.10
R3441:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3442:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3608:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R3686:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4119:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4120:Cdh15	UTSW	8	123,590,162 (GRCm39)	missense	probably damaging	1.00
R4477:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4478:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4480:Cdh15	UTSW	8	123,591,415 (GRCm39)	missense	probably benign	0.00
R4580:Cdh15	UTSW	8	123,591,897 (GRCm39)	missense	probably damaging	0.99
R4583:Cdh15	UTSW	8	123,591,767 (GRCm39)	missense	probably damaging	0.98
R4619:Cdh15	UTSW	8	123,587,612 (GRCm39)	missense	probably damaging	1.00
R4694:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R4731:Cdh15	UTSW	8	123,588,763 (GRCm39)	missense	probably damaging	1.00
R5076:Cdh15	UTSW	8	123,591,087 (GRCm39)	missense	possibly damaging	0.82
R5347:Cdh15	UTSW	8	123,588,802 (GRCm39)	missense	probably null	1.00
R5375:Cdh15	UTSW	8	123,591,839 (GRCm39)	missense	probably damaging	1.00
R5778:Cdh15	UTSW	8	123,583,326 (GRCm39)	missense	possibly damaging	0.80
R6320:Cdh15	UTSW	8	123,591,086 (GRCm39)	missense	probably benign	0.01
R6570:Cdh15	UTSW	8	123,584,130 (GRCm39)	missense	probably damaging	1.00
R6708:Cdh15	UTSW	8	123,590,294 (GRCm39)	missense	probably benign	0.32
R7505:Cdh15	UTSW	8	123,575,231 (GRCm39)	missense	probably benign	0.01
R7527:Cdh15	UTSW	8	123,588,865 (GRCm39)	missense	probably damaging	1.00
R7724:Cdh15	UTSW	8	123,593,700 (GRCm39)	missense	probably damaging	1.00
R8093:Cdh15	UTSW	8	123,593,574 (GRCm39)	missense	probably damaging	1.00
R8485:Cdh15	UTSW	8	123,584,105 (GRCm39)	missense	probably damaging	1.00
R8759:Cdh15	UTSW	8	123,587,628 (GRCm39)	missense	probably damaging	1.00
R8910:Cdh15	UTSW	8	123,575,240 (GRCm39)	missense	probably benign	0.04
R9017:Cdh15	UTSW	8	123,584,256 (GRCm39)	critical splice donor site	probably null
R9453:Cdh15	UTSW	8	123,586,029 (GRCm39)	missense	probably damaging	0.99
R9699:Cdh15	UTSW	8	123,588,769 (GRCm39)	missense	probably benign	0.00
R9705:Cdh15	UTSW	8	123,591,024 (GRCm39)	missense	probably damaging	1.00
Z1176:Cdh15	UTSW	8	123,590,998 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTACAGTGAGCCATGCACG -3'
(R):5'- AGGCCATGCAACAGACTCTTG -3'

Sequencing Primer
(F):5'- GCTTGCGGCTCCGACATC -3'
(R):5'- AGACTCTTGCCCCGGGAATG -3'

Posted On

2016-10-05