Mutagenetix > Incidental Mutations

Incidental Mutation 'R5498:Slc16a10'

432480

Institutional Source

Beutler Lab

Gene Symbol

Slc16a10

Ensembl Gene

ENSMUSG00000019838

Gene Name

solute carrier family 16 (monocarboxylic acid transporters), member 10

Synonyms

Mct10, 2610103N14Rik, TAT1, PRO0813

MMRRC Submission

043059-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R5498 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40033532-40142258 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 40037327 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 462 (V462M)

Ref Sequence

ENSEMBL: ENSMUSP00000090227 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092566]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092566
AA Change: V462M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: V462M

Domain	Start	End	E-Value	Type
Pfam:MFS_1	66	320	1.1e-13	PFAM
Pfam:MFS_4	269	464	4.3e-11	PFAM
Pfam:MFS_1	291	507	4.3e-18	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213827
AA Change: V175M

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.8%
20x: 89.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	A	G	6: 149,328,240	D928G	probably damaging	Het
4930522L14Rik	T	A	5: 109,737,547	K148N	probably benign	Het
Abca6	T	A	11: 110,208,844	D959V	possibly damaging	Het
Acot12	T	C	13: 91,781,233	V393A	probably damaging	Het
Ano3	C	A	2: 110,697,103	V587F	possibly damaging	Het
Bub1	T	C	2: 127,814,709	D471G	possibly damaging	Het
Cdh15	G	T	8: 122,865,178	V601F	possibly damaging	Het
Cdt1	C	T	8: 122,570,500	R311W	probably damaging	Het
Cnot1	A	T	8: 95,757,355	I706N	possibly damaging	Het
Fbn1	A	G	2: 125,360,176	I1259T	probably damaging	Het
Furin	A	T	7: 80,391,794	W539R	probably damaging	Het
Hivep1	A	T	13: 42,123,158		probably null	Het
Igkv3-9	A	G	6: 70,588,743	M109V	probably benign	Het
Klf10	G	A	15: 38,296,039	R421W	probably damaging	Het
Mtor	A	T	4: 148,540,364	Y2144F	possibly damaging	Het
Mybpc2	T	C	7: 44,516,265	Y297C	probably damaging	Het
Myom2	G	A	8: 15,129,142	E1325K	probably benign	Het
Nsd1	A	T	13: 55,213,302	K28*	probably null	Het
Olfr458	C	T	6: 42,460,294	A242T	probably benign	Het
Olfr66	T	G	7: 103,881,632	T204P	probably damaging	Het
Phc2	C	A	4: 128,708,994	N120K	probably benign	Het
Pias3	A	G	3: 96,702,188	T274A	possibly damaging	Het
Plcb4	T	A	2: 135,976,172	I786N	probably damaging	Het
Plec	G	A	15: 76,177,454	S2626L	probably damaging	Het
Polg	A	G	7: 79,454,670	L819P	probably damaging	Het
Ppp2r3d	T	C	9: 124,439,123		probably benign	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rnpc3	A	G	3: 113,611,207		probably null	Het
Sarnp	T	A	10: 128,853,194	D65E	probably benign	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc45a2	C	T	15: 11,027,785	T480I	probably damaging	Het
Slfn5	A	T	11: 82,957,147	H286L	possibly damaging	Het
Spag17	G	A	3: 100,103,345	A2052T	possibly damaging	Het
Sptbn5	A	T	2: 120,076,638		probably benign	Het
Tlr3	C	T	8: 45,398,814	D349N	possibly damaging	Het
Trim45	T	C	3: 100,925,141	V230A	possibly damaging	Het
Ube3b	T	C	5: 114,418,574	F989L	probably damaging	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wdr24	A	G	17: 25,824,561	H119R	probably damaging	Het
Yars2	T	A	16: 16,306,523	H331Q	possibly damaging	Het
Zscan21	T	C	5: 138,133,260	S349P	probably benign	Het

Other mutations in Slc16a10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01140:Slc16a10	APN	10	40076925	missense	probably damaging	1.00
R0030:Slc16a10	UTSW	10	40076823	missense	probably benign	0.04
R0196:Slc16a10	UTSW	10	40056615	missense	probably benign	0.01
R0200:Slc16a10	UTSW	10	40040616	missense	probably benign	0.37
R0418:Slc16a10	UTSW	10	40040631	nonsense	probably null
R0463:Slc16a10	UTSW	10	40040616	missense	probably benign	0.37
R0599:Slc16a10	UTSW	10	40141918	missense	probably benign
R1162:Slc16a10	UTSW	10	40076553	missense	probably benign	0.00
R1554:Slc16a10	UTSW	10	40076800	missense	probably benign	0.00
R1901:Slc16a10	UTSW	10	40056606	nonsense	probably null
R3622:Slc16a10	UTSW	10	40141894	missense	probably benign
R3624:Slc16a10	UTSW	10	40141894	missense	probably benign
R3717:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3719:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3729:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3730:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3731:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3801:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3803:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R3804:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R4037:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R4038:Slc16a10	UTSW	10	40056624	missense	possibly damaging	0.94
R4254:Slc16a10	UTSW	10	40077001	missense	probably damaging	1.00
R4980:Slc16a10	UTSW	10	40080805	missense	probably damaging	1.00
R5542:Slc16a10	UTSW	10	40076788	missense	probably benign	0.03
R6541:Slc16a10	UTSW	10	40037272	missense	probably benign	0.00
R6555:Slc16a10	UTSW	10	40080778	missense	probably benign	0.41
R6998:Slc16a10	UTSW	10	40056503	missense	possibly damaging	0.63
R7171:Slc16a10	UTSW	10	40037259	missense	probably benign	0.03
R7354:Slc16a10	UTSW	10	40076955	missense	probably damaging	1.00
R7728:Slc16a10	UTSW	10	40040758	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCATTTGTGCTATTCCAAGGATG -3'
(R):5'- CATTTCAAATCTGTGATCTGAGCC -3'

Sequencing Primer
(F):5'- TTCAAAAGCAAATCCCGTGAG -3'
(R):5'- AATCTGTGATCTGAGCCTGCGATC -3'

Posted On

2016-10-05