Incidental Mutation 'R5498:Slfn5'
ID432483
Institutional Source Beutler Lab
Gene Symbol Slfn5
Ensembl Gene ENSMUSG00000054404
Gene Nameschlafen 5
Synonyms
MMRRC Submission 043059-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R5498 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location82951349-82964840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82957147 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 286 (H286L)
Ref Sequence ENSEMBL: ENSMUSP00000103793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067443] [ENSMUST00000108157] [ENSMUST00000108158]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067443
AA Change: H286L

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064819
Gene: ENSMUSG00000054404
AA Change: H286L

DomainStartEndE-ValueType
Pfam:AlbA_2 187 319 4.7e-13 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 743 4.7e-8 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108157
AA Change: H286L

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103792
Gene: ENSMUSG00000054404
AA Change: H286L

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 1.9e-15 PFAM
low complexity region 537 547 N/A INTRINSIC
Pfam:DUF2075 567 739 9.4e-9 PFAM
transmembrane domain 848 870 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108158
AA Change: H286L

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103793
Gene: ENSMUSG00000054404
AA Change: H286L

DomainStartEndE-ValueType
Pfam:AAA_4 187 320 3.4e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216469
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A G 6: 149,328,240 D928G probably damaging Het
4930522L14Rik T A 5: 109,737,547 K148N probably benign Het
Abca6 T A 11: 110,208,844 D959V possibly damaging Het
Acot12 T C 13: 91,781,233 V393A probably damaging Het
Ano3 C A 2: 110,697,103 V587F possibly damaging Het
Bub1 T C 2: 127,814,709 D471G possibly damaging Het
Cdh15 G T 8: 122,865,178 V601F possibly damaging Het
Cdt1 C T 8: 122,570,500 R311W probably damaging Het
Cnot1 A T 8: 95,757,355 I706N possibly damaging Het
Fbn1 A G 2: 125,360,176 I1259T probably damaging Het
Furin A T 7: 80,391,794 W539R probably damaging Het
Hivep1 A T 13: 42,123,158 probably null Het
Igkv3-9 A G 6: 70,588,743 M109V probably benign Het
Klf10 G A 15: 38,296,039 R421W probably damaging Het
Mtor A T 4: 148,540,364 Y2144F possibly damaging Het
Mybpc2 T C 7: 44,516,265 Y297C probably damaging Het
Myom2 G A 8: 15,129,142 E1325K probably benign Het
Nsd1 A T 13: 55,213,302 K28* probably null Het
Olfr458 C T 6: 42,460,294 A242T probably benign Het
Olfr66 T G 7: 103,881,632 T204P probably damaging Het
Phc2 C A 4: 128,708,994 N120K probably benign Het
Pias3 A G 3: 96,702,188 T274A possibly damaging Het
Plcb4 T A 2: 135,976,172 I786N probably damaging Het
Plec G A 15: 76,177,454 S2626L probably damaging Het
Polg A G 7: 79,454,670 L819P probably damaging Het
Ppp2r3d T C 9: 124,439,123 probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rnpc3 A G 3: 113,611,207 probably null Het
Sarnp T A 10: 128,853,194 D65E probably benign Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc16a10 C T 10: 40,037,327 V462M probably damaging Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Spag17 G A 3: 100,103,345 A2052T possibly damaging Het
Sptbn5 A T 2: 120,076,638 probably benign Het
Tlr3 C T 8: 45,398,814 D349N possibly damaging Het
Trim45 T C 3: 100,925,141 V230A possibly damaging Het
Ube3b T C 5: 114,418,574 F989L probably damaging Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wdr24 A G 17: 25,824,561 H119R probably damaging Het
Yars2 T A 16: 16,306,523 H331Q possibly damaging Het
Zscan21 T C 5: 138,133,260 S349P probably benign Het
Other mutations in Slfn5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Slfn5 APN 11 82956981 missense probably damaging 0.97
IGL01773:Slfn5 APN 11 82961331 missense probably damaging 1.00
IGL03026:Slfn5 APN 11 82956561 missense probably benign
IGL03368:Slfn5 APN 11 82956385 missense possibly damaging 0.88
R0531:Slfn5 UTSW 11 82961040 missense probably damaging 0.99
R0690:Slfn5 UTSW 11 82961403 missense probably damaging 1.00
R0939:Slfn5 UTSW 11 82961338 missense probably benign 0.04
R1005:Slfn5 UTSW 11 82960158 missense probably damaging 1.00
R1214:Slfn5 UTSW 11 82960091 missense probably benign 0.01
R1978:Slfn5 UTSW 11 82956616 missense probably benign 0.17
R4092:Slfn5 UTSW 11 82961067 missense probably damaging 1.00
R4620:Slfn5 UTSW 11 82961652 missense probably damaging 1.00
R4789:Slfn5 UTSW 11 82956400 missense probably benign 0.00
R5113:Slfn5 UTSW 11 82961696 missense probably benign 0.01
R5120:Slfn5 UTSW 11 82960928 missense probably damaging 1.00
R5262:Slfn5 UTSW 11 82956670 missense possibly damaging 0.56
R5307:Slfn5 UTSW 11 82956385 missense probably damaging 0.96
R5451:Slfn5 UTSW 11 82960086 missense probably damaging 1.00
R5651:Slfn5 UTSW 11 82960664 missense probably benign 0.00
R5777:Slfn5 UTSW 11 82961004 missense probably damaging 0.99
R5906:Slfn5 UTSW 11 82957276 missense probably benign 0.37
R5934:Slfn5 UTSW 11 82956592 missense probably damaging 1.00
R6521:Slfn5 UTSW 11 82960415 missense probably damaging 0.99
R6543:Slfn5 UTSW 11 82958666 splice site probably null
R6681:Slfn5 UTSW 11 82956378 missense possibly damaging 0.73
R7129:Slfn5 UTSW 11 82961150 nonsense probably null
R7309:Slfn5 UTSW 11 82956703 missense probably damaging 1.00
R7478:Slfn5 UTSW 11 82960616 missense probably damaging 1.00
R7573:Slfn5 UTSW 11 82958759 missense probably damaging 1.00
R7610:Slfn5 UTSW 11 82961484 missense probably damaging 1.00
R7834:Slfn5 UTSW 11 82960452 missense possibly damaging 0.88
R7957:Slfn5 UTSW 11 82956787 missense probably benign 0.00
R8205:Slfn5 UTSW 11 82960718 missense probably benign 0.04
R8264:Slfn5 UTSW 11 82956550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGTTTCTGCACTTGC -3'
(R):5'- CCAGCAACATTTCCGTCTTG -3'

Sequencing Primer
(F):5'- GCACTTGCCAATTCTGAAGG -3'
(R):5'- GTCTTGTTCCCTGACCTGG -3'
Posted On2016-10-05