Incidental Mutation 'R5485:Abcb8'
ID432510
Institutional Source Beutler Lab
Gene Symbol Abcb8
Ensembl Gene ENSMUSG00000028973
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 8
Synonyms
MMRRC Submission 043046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.204) question?
Stock #R5485 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24393663-24410054 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24400161 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 115 (N115S)
Ref Sequence ENSEMBL: ENSMUSP00000119791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]
Predicted Effect probably benign
Transcript: ENSMUST00000073076
AA Change: N115S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: N115S

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115074
SMART Domains Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115077
AA Change: N115S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: N115S

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127816
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136414
Predicted Effect probably benign
Transcript: ENSMUST00000138168
AA Change: N115S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973
AA Change: N115S

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198166
Meta Mutation Damage Score 0.1412 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,378 V85D probably benign Het
Appl1 C A 14: 26,962,866 L75F probably damaging Het
Atp13a5 A G 16: 29,281,942 probably null Het
Atp2c2 T A 8: 119,753,062 probably null Het
Cfap54 T A 10: 93,029,117 I94F probably damaging Het
Clasp1 A G 1: 118,467,913 I194V possibly damaging Het
Crebbp A C 16: 4,114,913 D1000E probably benign Het
Ctdnep1 C T 11: 69,981,490 R3W possibly damaging Het
Dgkb T C 12: 38,127,364 V230A probably damaging Het
Duoxa2 T C 2: 122,299,152 F38L possibly damaging Het
Ecd T C 14: 20,338,205 S172G probably benign Het
Endog G T 2: 30,171,651 probably benign Het
Eqtn G A 4: 94,924,956 P131L possibly damaging Het
Gabbr1 T A 17: 37,056,875 S290T possibly damaging Het
Glt8d2 T A 10: 82,651,448 R319S possibly damaging Het
Gm16686 A G 4: 88,755,404 probably benign Het
Gm5709 A T 3: 59,635,562 noncoding transcript Het
Gm7381 T C 8: 3,842,161 noncoding transcript Het
Gorab T G 1: 163,386,302 D353A possibly damaging Het
Gstm1 A G 3: 108,017,404 L20P probably damaging Het
Hexim2 A G 11: 103,139,058 D312G probably benign Het
Hfm1 A G 5: 106,847,662 probably null Het
Mbd4 C A 6: 115,850,718 A66S probably benign Het
Mmp27 T A 9: 7,573,362 W152R probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mrps18b A T 17: 35,914,344 V102D probably damaging Het
Olfr1513 A T 14: 52,349,319 C242* probably null Het
Peg10 T A 6: 4,755,565 M47K probably benign Het
Plxnc1 T G 10: 94,922,742 Q364P probably benign Het
Psd A T 19: 46,316,089 probably null Het
Rims1 T G 1: 22,483,208 I470L possibly damaging Het
Sbsn T C 7: 30,753,117 V519A possibly damaging Het
Senp1 A G 15: 98,066,496 V279A probably benign Het
Sfxn5 T A 6: 85,332,600 probably benign Het
Slc6a13 T A 6: 121,336,073 M483K probably damaging Het
Slc6a21 G A 7: 45,282,542 probably null Het
Slco6c1 T C 1: 97,125,756 Y140C probably damaging Het
Spata32 A G 11: 103,209,296 S128P probably damaging Het
Spty2d1 G T 7: 46,997,885 T432K possibly damaging Het
Stx8 A G 11: 68,020,966 Q170R probably benign Het
Sytl3 G A 17: 6,715,480 V112I probably benign Het
Tdrkh A G 3: 94,428,712 I420V probably benign Het
Tmem117 T C 15: 95,094,830 V457A probably benign Het
Tpk1 T C 6: 43,665,812 probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Tsen54 A G 11: 115,815,222 E90G probably benign Het
Ugt1a2 A T 1: 88,201,246 M204L probably damaging Het
Vmn2r17 A T 5: 109,420,106 I32F probably benign Het
Xkr6 T C 14: 63,819,384 V248A unknown Het
Zfhx4 C A 3: 5,243,007 S431Y probably damaging Het
Zfp318 T A 17: 46,412,254 S1728T possibly damaging Het
Zfp563 T C 17: 33,089,566 probably benign Het
Other mutations in Abcb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Abcb8 APN 5 24406464 missense probably benign
IGL02819:Abcb8 APN 5 24406424 missense probably benign
Thumbs UTSW 5 24402103 missense probably damaging 0.99
R0320:Abcb8 UTSW 5 24400790 missense probably damaging 1.00
R0458:Abcb8 UTSW 5 24406233 missense probably benign 0.02
R0927:Abcb8 UTSW 5 24402319 missense probably damaging 1.00
R1120:Abcb8 UTSW 5 24408820 critical splice donor site probably null
R1553:Abcb8 UTSW 5 24408750 missense probably damaging 1.00
R3738:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R3739:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4035:Abcb8 UTSW 5 24400621 missense probably benign 0.00
R4303:Abcb8 UTSW 5 24401057 missense probably damaging 1.00
R4930:Abcb8 UTSW 5 24400781 missense possibly damaging 0.89
R5369:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5370:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5505:Abcb8 UTSW 5 24401038 missense probably damaging 1.00
R5627:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5633:Abcb8 UTSW 5 24403109 missense probably damaging 1.00
R5693:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5761:Abcb8 UTSW 5 24405881 intron probably benign
R5866:Abcb8 UTSW 5 24402103 missense probably damaging 0.99
R5995:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R5996:Abcb8 UTSW 5 24400139 missense possibly damaging 0.75
R6621:Abcb8 UTSW 5 24394510 missense probably benign
R7407:Abcb8 UTSW 5 24400676 missense probably benign 0.00
X0026:Abcb8 UTSW 5 24401046 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTTAGTAATTTGAAGGACAGCCAG -3'
(R):5'- AGCCCCTTGCACAGGTTATC -3'

Sequencing Primer
(F):5'- AGGCCCACAGCTGTCAATG -3'
(R):5'- TGCACAGGTTATCCCGATG -3'
Posted On2016-10-05