Mutagenetix > Incidental Mutations

Incidental Mutation 'R5485:Abcb8'

432510

Institutional Source

Beutler Lab

Gene Symbol

Abcb8

Ensembl Gene

ENSMUSG00000028973

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 8

Synonyms

MMRRC Submission

043046-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R5485 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24393663-24410054 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24400161 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 115 (N115S)

Ref Sequence

ENSEMBL: ENSMUSP00000119791 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]

Predicted Effect

probably benign
Transcript: ENSMUST00000073076
AA Change: N115S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973
AA Change: N115S

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC
Pfam:ABC_membrane	130	407	3.6e-48	PFAM
AAA	481	668	8.58e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000115074

SMART Domains

Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC
Pfam:ABC_membrane	130	407	2.7e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000115077
AA Change: N115S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973
AA Change: N115S

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC
Pfam:ABC_membrane	130	407	1.1e-56	PFAM
AAA	481	668	8.58e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127816

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136414

Predicted Effect

probably benign
Transcript: ENSMUST00000138168
AA Change: N115S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973
AA Change: N115S

Domain	Start	End	E-Value	Type
low complexity region	29	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000198166

Meta Mutation Damage Score

0.1412

Coding Region Coverage

1x: 98.2%
3x: 97.3%
10x: 95.1%
20x: 90.6%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This nuclear gene encodes a multi-pass membrane protein that is targeted to the mitochondrial inner membrane. The encoded protein is an ATP-dependent transporter that may mediate the passage of organic and inorganic molecules out of the mitochondria. Loss of function of the related gene in mouse results in a disruption of iron homeostasis between the mitochondria and cytosol. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Inducible cardiac specific deletion results in mild cardiomyopathy, mitochondrial defects and elevated heart mitochondrial iron levels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	A	T	11: 23,517,378	V85D	probably benign	Het
Appl1	C	A	14: 26,962,866	L75F	probably damaging	Het
Atp13a5	A	G	16: 29,281,942		probably null	Het
Atp2c2	T	A	8: 119,753,062		probably null	Het
Cfap54	T	A	10: 93,029,117	I94F	probably damaging	Het
Clasp1	A	G	1: 118,467,913	I194V	possibly damaging	Het
Crebbp	A	C	16: 4,114,913	D1000E	probably benign	Het
Ctdnep1	C	T	11: 69,981,490	R3W	possibly damaging	Het
Dgkb	T	C	12: 38,127,364	V230A	probably damaging	Het
Duoxa2	T	C	2: 122,299,152	F38L	possibly damaging	Het
Ecd	T	C	14: 20,338,205	S172G	probably benign	Het
Endog	G	T	2: 30,171,651		probably benign	Het
Eqtn	G	A	4: 94,924,956	P131L	possibly damaging	Het
Gabbr1	T	A	17: 37,056,875	S290T	possibly damaging	Het
Glt8d2	T	A	10: 82,651,448	R319S	possibly damaging	Het
Gm16686	A	G	4: 88,755,404		probably benign	Het
Gm5709	A	T	3: 59,635,562		noncoding transcript	Het
Gm7381	T	C	8: 3,842,161		noncoding transcript	Het
Gorab	T	G	1: 163,386,302	D353A	possibly damaging	Het
Gstm1	A	G	3: 108,017,404	L20P	probably damaging	Het
Hexim2	A	G	11: 103,139,058	D312G	probably benign	Het
Hfm1	A	G	5: 106,847,662		probably null	Het
Mbd4	C	A	6: 115,850,718	A66S	probably benign	Het
Mmp27	T	A	9: 7,573,362	W152R	probably damaging	Het
Mogat1	A	G	1: 78,523,670	T124A	probably benign	Het
Mrps18b	A	T	17: 35,914,344	V102D	probably damaging	Het
Olfr1513	A	T	14: 52,349,319	C242*	probably null	Het
Peg10	T	A	6: 4,755,565	M47K	probably benign	Het
Plxnc1	T	G	10: 94,922,742	Q364P	probably benign	Het
Psd	A	T	19: 46,316,089		probably null	Het
Rims1	T	G	1: 22,483,208	I470L	possibly damaging	Het
Sbsn	T	C	7: 30,753,117	V519A	possibly damaging	Het
Senp1	A	G	15: 98,066,496	V279A	probably benign	Het
Sfxn5	T	A	6: 85,332,600		probably benign	Het
Slc6a13	T	A	6: 121,336,073	M483K	probably damaging	Het
Slc6a21	G	A	7: 45,282,542		probably null	Het
Slco6c1	T	C	1: 97,125,756	Y140C	probably damaging	Het
Spata32	A	G	11: 103,209,296	S128P	probably damaging	Het
Spty2d1	G	T	7: 46,997,885	T432K	possibly damaging	Het
Stx8	A	G	11: 68,020,966	Q170R	probably benign	Het
Sytl3	G	A	17: 6,715,480	V112I	probably benign	Het
Tdrkh	A	G	3: 94,428,712	I420V	probably benign	Het
Tmem117	T	C	15: 95,094,830	V457A	probably benign	Het
Tpk1	T	C	6: 43,665,812		probably benign	Het
Trpc2	GTGTCCTA	GTGTCCTATGTCCTA	7: 102,095,213		probably null	Het
Tsen54	A	G	11: 115,815,222	E90G	probably benign	Het
Ugt1a2	A	T	1: 88,201,246	M204L	probably damaging	Het
Vmn2r17	A	T	5: 109,420,106	I32F	probably benign	Het
Xkr6	T	C	14: 63,819,384	V248A	unknown	Het
Zfhx4	C	A	3: 5,243,007	S431Y	probably damaging	Het
Zfp318	T	A	17: 46,412,254	S1728T	possibly damaging	Het
Zfp563	T	C	17: 33,089,566		probably benign	Het

Other mutations in Abcb8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02349:Abcb8	APN	5	24406464	missense	probably benign
IGL02819:Abcb8	APN	5	24406424	missense	probably benign
Thumbs	UTSW	5	24402103	missense	probably damaging	0.99
R0320:Abcb8	UTSW	5	24400790	missense	probably damaging	1.00
R0458:Abcb8	UTSW	5	24406233	missense	probably benign	0.02
R0927:Abcb8	UTSW	5	24402319	missense	probably damaging	1.00
R1120:Abcb8	UTSW	5	24408820	critical splice donor site	probably null
R1553:Abcb8	UTSW	5	24408750	missense	probably damaging	1.00
R3738:Abcb8	UTSW	5	24400621	missense	probably benign	0.00
R3739:Abcb8	UTSW	5	24400621	missense	probably benign	0.00
R4035:Abcb8	UTSW	5	24400621	missense	probably benign	0.00
R4303:Abcb8	UTSW	5	24401057	missense	probably damaging	1.00
R4930:Abcb8	UTSW	5	24400781	missense	possibly damaging	0.89
R5369:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5370:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5505:Abcb8	UTSW	5	24401038	missense	probably damaging	1.00
R5627:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5633:Abcb8	UTSW	5	24403109	missense	probably damaging	1.00
R5693:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5761:Abcb8	UTSW	5	24405881	intron	probably benign
R5866:Abcb8	UTSW	5	24402103	missense	probably damaging	0.99
R5995:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R5996:Abcb8	UTSW	5	24400139	missense	possibly damaging	0.75
R6621:Abcb8	UTSW	5	24394510	missense	probably benign
R7407:Abcb8	UTSW	5	24400676	missense	probably benign	0.00
X0026:Abcb8	UTSW	5	24401046	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GTTAGTAATTTGAAGGACAGCCAG -3'
(R):5'- AGCCCCTTGCACAGGTTATC -3'

Sequencing Primer
(F):5'- AGGCCCACAGCTGTCAATG -3'
(R):5'- TGCACAGGTTATCCCGATG -3'

Posted On

2016-10-05