Incidental Mutation 'R5485:Slc6a21'
ID432519
Institutional Source Beutler Lab
Gene Symbol Slc6a21
Ensembl Gene ENSMUSG00000070568
Gene Namesolute carrier family 6 member 21
Synonyms1700039E15Rik
MMRRC Submission 043046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R5485 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45277513-45288998 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 45282542 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]
Predicted Effect probably benign
Transcript: ENSMUST00000085364
SMART Domains Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568

DomainStartEndE-ValueType
Pfam:SNF 1 306 8.3e-37 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000176133
Predicted Effect probably null
Transcript: ENSMUST00000176276
SMART Domains Protein: ENSMUSP00000135707
Gene: ENSMUSG00000070568

DomainStartEndE-ValueType
Pfam:SNF 48 631 2e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209886
Predicted Effect probably benign
Transcript: ENSMUST00000210207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210733
Predicted Effect probably null
Transcript: ENSMUST00000210861
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.6%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,378 V85D probably benign Het
Abcb8 A G 5: 24,400,161 N115S probably benign Het
Appl1 C A 14: 26,962,866 L75F probably damaging Het
Atp13a5 A G 16: 29,281,942 probably null Het
Atp2c2 T A 8: 119,753,062 probably null Het
Cfap54 T A 10: 93,029,117 I94F probably damaging Het
Clasp1 A G 1: 118,467,913 I194V possibly damaging Het
Crebbp A C 16: 4,114,913 D1000E probably benign Het
Ctdnep1 C T 11: 69,981,490 R3W possibly damaging Het
Dgkb T C 12: 38,127,364 V230A probably damaging Het
Duoxa2 T C 2: 122,299,152 F38L possibly damaging Het
Ecd T C 14: 20,338,205 S172G probably benign Het
Endog G T 2: 30,171,651 probably benign Het
Eqtn G A 4: 94,924,956 P131L possibly damaging Het
Gabbr1 T A 17: 37,056,875 S290T possibly damaging Het
Glt8d2 T A 10: 82,651,448 R319S possibly damaging Het
Gm16686 A G 4: 88,755,404 probably benign Het
Gm5709 A T 3: 59,635,562 noncoding transcript Het
Gm7381 T C 8: 3,842,161 noncoding transcript Het
Gorab T G 1: 163,386,302 D353A possibly damaging Het
Gstm1 A G 3: 108,017,404 L20P probably damaging Het
Hexim2 A G 11: 103,139,058 D312G probably benign Het
Hfm1 A G 5: 106,847,662 probably null Het
Mbd4 C A 6: 115,850,718 A66S probably benign Het
Mmp27 T A 9: 7,573,362 W152R probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mrps18b A T 17: 35,914,344 V102D probably damaging Het
Olfr1513 A T 14: 52,349,319 C242* probably null Het
Peg10 T A 6: 4,755,565 M47K probably benign Het
Plxnc1 T G 10: 94,922,742 Q364P probably benign Het
Psd A T 19: 46,316,089 probably null Het
Rims1 T G 1: 22,483,208 I470L possibly damaging Het
Sbsn T C 7: 30,753,117 V519A possibly damaging Het
Senp1 A G 15: 98,066,496 V279A probably benign Het
Sfxn5 T A 6: 85,332,600 probably benign Het
Slc6a13 T A 6: 121,336,073 M483K probably damaging Het
Slco6c1 T C 1: 97,125,756 Y140C probably damaging Het
Spata32 A G 11: 103,209,296 S128P probably damaging Het
Spty2d1 G T 7: 46,997,885 T432K possibly damaging Het
Stx8 A G 11: 68,020,966 Q170R probably benign Het
Sytl3 G A 17: 6,715,480 V112I probably benign Het
Tdrkh A G 3: 94,428,712 I420V probably benign Het
Tmem117 T C 15: 95,094,830 V457A probably benign Het
Tpk1 T C 6: 43,665,812 probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Tsen54 A G 11: 115,815,222 E90G probably benign Het
Ugt1a2 A T 1: 88,201,246 M204L probably damaging Het
Vmn2r17 A T 5: 109,420,106 I32F probably benign Het
Xkr6 T C 14: 63,819,384 V248A unknown Het
Zfhx4 C A 3: 5,243,007 S431Y probably damaging Het
Zfp318 T A 17: 46,412,254 S1728T possibly damaging Het
Zfp563 T C 17: 33,089,566 probably benign Het
Other mutations in Slc6a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Slc6a21 APN 7 45288244 missense probably benign 0.31
IGL01526:Slc6a21 APN 7 45287796 missense probably damaging 1.00
IGL01670:Slc6a21 APN 7 45288133 missense possibly damaging 0.91
IGL01975:Slc6a21 APN 7 45287851 missense probably benign 0.28
IGL02064:Slc6a21 APN 7 45286459 missense possibly damaging 0.71
IGL02441:Slc6a21 APN 7 45288081 missense probably damaging 1.00
IGL02735:Slc6a21 APN 7 45286637 splice site probably benign
IGL03097:Slc6a21 UTSW 7 45288168 nonsense probably null
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0269:Slc6a21 UTSW 7 45286908 nonsense probably null
R0336:Slc6a21 UTSW 7 45286468 missense probably damaging 1.00
R1077:Slc6a21 UTSW 7 45288202 missense probably benign 0.42
R1476:Slc6a21 UTSW 7 45272628 missense probably benign 0.09
R1763:Slc6a21 UTSW 7 45287734 nonsense probably null
R1792:Slc6a21 UTSW 7 45280731 missense probably benign 0.04
R1796:Slc6a21 UTSW 7 45280755 missense probably damaging 1.00
R1812:Slc6a21 UTSW 7 45282947 missense probably damaging 1.00
R1868:Slc6a21 UTSW 7 45287828 missense probably benign 0.13
R2121:Slc6a21 UTSW 7 45288462 missense probably benign 0.04
R2129:Slc6a21 UTSW 7 45282773 splice site probably null
R2294:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2295:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2409:Slc6a21 UTSW 7 45280326 missense probably benign 0.15
R2858:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R3498:Slc6a21 UTSW 7 45280842 missense probably damaging 1.00
R3751:Slc6a21 UTSW 7 45280504 missense probably benign
R4297:Slc6a21 UTSW 7 45287762 missense possibly damaging 0.95
R4510:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4511:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4876:Slc6a21 UTSW 7 45280111 nonsense probably null
R4921:Slc6a21 UTSW 7 45288310 missense possibly damaging 0.53
R5559:Slc6a21 UTSW 7 45288429 missense possibly damaging 0.61
R6305:Slc6a21 UTSW 7 45280604 missense possibly damaging 0.88
R6390:Slc6a21 UTSW 7 45287002 missense probably benign 0.02
R6571:Slc6a21 UTSW 7 45280879 missense probably damaging 0.99
R6792:Slc6a21 UTSW 7 45279885 start codon destroyed probably null 0.02
R7235:Slc6a21 UTSW 7 45280758 missense probably damaging 0.99
R7278:Slc6a21 UTSW 7 45282480 missense possibly damaging 0.84
R7808:Slc6a21 UTSW 7 45282936 missense
Predicted Primers PCR Primer
(F):5'- GTGGCATTCCTCAGACACTG -3'
(R):5'- CGTCCAGTGATGACAGGATG -3'

Sequencing Primer
(F):5'- AGACACTGCCTTCCTGCACG -3'
(R):5'- TGTGGAAGACAGAGGCATTTG -3'
Posted On2016-10-05