Incidental Mutation 'R5485:Mmp27'
ID 432524
Institutional Source Beutler Lab
Gene Symbol Mmp27
Ensembl Gene ENSMUSG00000070323
Gene Name matrix metallopeptidase 27
Synonyms LOC234911
MMRRC Submission 043046-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock # R5485 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 7571396-7581885 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 7573362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 152 (W152R)
Ref Sequence ENSEMBL: ENSMUSP00000117469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018765] [ENSMUST00000120900] [ENSMUST00000151853]
AlphaFold D3YV89
Predicted Effect probably benign
Transcript: ENSMUST00000018765
SMART Domains Protein: ENSMUSP00000018765
Gene: ENSMUSG00000005800

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:PG_binding_1 28 86 2e-13 PFAM
ZnMc 104 263 4.38e-60 SMART
HX 285 327 7.51e-10 SMART
HX 329 372 2.16e-10 SMART
HX 377 422 5.91e-17 SMART
HX 424 464 2.99e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120900
AA Change: W152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113231
Gene: ENSMUSG00000070323
AA Change: W152R

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1e-13 PFAM
ZnMc 116 277 1.76e-50 SMART
HX 300 342 5.97e-4 SMART
HX 344 386 1.1e-7 SMART
HX 391 438 1.09e-6 SMART
HX 440 480 3.2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151853
AA Change: W152R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117469
Gene: ENSMUSG00000070323
AA Change: W152R

DomainStartEndE-ValueType
Pfam:PG_binding_1 40 100 1.1e-13 PFAM
ZnMc 116 303 1.81e-43 SMART
HX 326 368 5.97e-4 SMART
HX 370 412 1.1e-7 SMART
HX 417 464 1.09e-6 SMART
HX 466 506 3.2e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000152878
AA Change: W150R
SMART Domains Protein: ENSMUSP00000116263
Gene: ENSMUSG00000070323
AA Change: W150R

DomainStartEndE-ValueType
Pfam:PG_binding_1 39 99 1.1e-13 PFAM
ZnMc 115 295 1.41e-13 SMART
HX 245 287 5.97e-4 SMART
HX 289 331 1.1e-7 SMART
HX 336 383 1.09e-6 SMART
HX 385 425 3.2e-4 SMART
Meta Mutation Damage Score 0.8951 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Proteins of the matrix metalloproteinase (MMP) family are involved in the breakdown of extracellular matrix in normal physiological processes, such as embryonic development, reproduction, and tissue remodeling, as well as in disease processes, such as arthritis and metastasis. Most MMP's are secreted as inactive proproteins which are activated when cleaved by extracellular proteinases. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,378 V85D probably benign Het
Abcb8 A G 5: 24,400,161 N115S probably benign Het
Appl1 C A 14: 26,962,866 L75F probably damaging Het
Atp13a5 A G 16: 29,281,942 probably null Het
Atp2c2 T A 8: 119,753,062 probably null Het
Cfap54 T A 10: 93,029,117 I94F probably damaging Het
Clasp1 A G 1: 118,467,913 I194V possibly damaging Het
Crebbp A C 16: 4,114,913 D1000E probably benign Het
Ctdnep1 C T 11: 69,981,490 R3W possibly damaging Het
Dgkb T C 12: 38,127,364 V230A probably damaging Het
Duoxa2 T C 2: 122,299,152 F38L possibly damaging Het
Ecd T C 14: 20,338,205 S172G probably benign Het
Endog G T 2: 30,171,651 probably benign Het
Eqtn G A 4: 94,924,956 P131L possibly damaging Het
Gabbr1 T A 17: 37,056,875 S290T possibly damaging Het
Glt8d2 T A 10: 82,651,448 R319S possibly damaging Het
Gm16686 A G 4: 88,755,404 probably benign Het
Gm5709 A T 3: 59,635,562 noncoding transcript Het
Gm7381 T C 8: 3,842,161 noncoding transcript Het
Gorab T G 1: 163,386,302 D353A possibly damaging Het
Gstm1 A G 3: 108,017,404 L20P probably damaging Het
Hexim2 A G 11: 103,139,058 D312G probably benign Het
Hfm1 A G 5: 106,847,662 probably null Het
Mbd4 C A 6: 115,850,718 A66S probably benign Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mrps18b A T 17: 35,914,344 V102D probably damaging Het
Olfr1513 A T 14: 52,349,319 C242* probably null Het
Peg10 T A 6: 4,755,565 M47K probably benign Het
Plxnc1 T G 10: 94,922,742 Q364P probably benign Het
Psd A T 19: 46,316,089 probably null Het
Rims1 T G 1: 22,483,208 I470L possibly damaging Het
Sbsn T C 7: 30,753,117 V519A possibly damaging Het
Senp1 A G 15: 98,066,496 V279A probably benign Het
Sfxn5 T A 6: 85,332,600 probably benign Het
Slc6a13 T A 6: 121,336,073 M483K probably damaging Het
Slc6a21 G A 7: 45,282,542 probably null Het
Slco6c1 T C 1: 97,125,756 Y140C probably damaging Het
Spata32 A G 11: 103,209,296 S128P probably damaging Het
Spty2d1 G T 7: 46,997,885 T432K possibly damaging Het
Stx8 A G 11: 68,020,966 Q170R probably benign Het
Sytl3 G A 17: 6,715,480 V112I probably benign Het
Tdrkh A G 3: 94,428,712 I420V probably benign Het
Tmem117 T C 15: 95,094,830 V457A probably benign Het
Tpk1 T C 6: 43,665,812 probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Tsen54 A G 11: 115,815,222 E90G probably benign Het
Ugt1a2 A T 1: 88,201,246 M204L probably damaging Het
Vmn2r17 A T 5: 109,420,106 I32F probably benign Het
Xkr6 T C 14: 63,819,384 V248A unknown Het
Zfhx4 C A 3: 5,243,007 S431Y probably damaging Het
Zfp318 T A 17: 46,412,254 S1728T possibly damaging Het
Zfp563 T C 17: 33,089,566 probably benign Het
Other mutations in Mmp27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Mmp27 APN 9 7573504 splice site probably benign
IGL00656:Mmp27 APN 9 7581382 missense possibly damaging 0.80
IGL00937:Mmp27 APN 9 7578899 critical splice acceptor site probably benign 0.00
IGL01101:Mmp27 APN 9 7573415 missense probably damaging 1.00
IGL01134:Mmp27 APN 9 7573297 missense probably benign 0.06
IGL01631:Mmp27 APN 9 7573288 critical splice acceptor site probably benign 0.00
IGL02967:Mmp27 APN 9 7571590 missense probably benign 0.03
IGL03024:Mmp27 APN 9 7581376 missense probably benign 0.17
R0662:Mmp27 UTSW 9 7577650 missense probably benign 0.00
R0715:Mmp27 UTSW 9 7581155 splice site probably benign
R0826:Mmp27 UTSW 9 7579009 missense probably damaging 1.00
R1191:Mmp27 UTSW 9 7579066 splice site probably null
R1793:Mmp27 UTSW 9 7571458 start codon destroyed probably null 0.00
R1983:Mmp27 UTSW 9 7578897 splice site probably null
R2074:Mmp27 UTSW 9 7577739 missense possibly damaging 0.50
R2172:Mmp27 UTSW 9 7577378 nonsense probably null
R2445:Mmp27 UTSW 9 7581181 missense probably benign 0.12
R2961:Mmp27 UTSW 9 7573602 missense probably damaging 1.00
R4825:Mmp27 UTSW 9 7581194 missense probably damaging 1.00
R4888:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R4938:Mmp27 UTSW 9 7578982 missense probably damaging 0.97
R5095:Mmp27 UTSW 9 7572158 missense probably damaging 1.00
R5095:Mmp27 UTSW 9 7579000 missense probably damaging 1.00
R5121:Mmp27 UTSW 9 7581368 missense probably benign 0.00
R5446:Mmp27 UTSW 9 7573515 splice site probably benign
R5516:Mmp27 UTSW 9 7579062 missense probably null 1.00
R6682:Mmp27 UTSW 9 7573605 missense probably benign 0.02
R6712:Mmp27 UTSW 9 7572176 missense probably damaging 1.00
R6737:Mmp27 UTSW 9 7571954 missense possibly damaging 0.78
R7282:Mmp27 UTSW 9 7578230 missense probably damaging 0.98
R7368:Mmp27 UTSW 9 7577317 missense probably damaging 1.00
R7689:Mmp27 UTSW 9 7579001 missense probably damaging 1.00
R8006:Mmp27 UTSW 9 7578984 missense probably damaging 0.97
R8185:Mmp27 UTSW 9 7573491 missense unknown
R8537:Mmp27 UTSW 9 7579775 missense probably benign 0.00
R9039:Mmp27 UTSW 9 7581249 missense probably benign 0.01
R9087:Mmp27 UTSW 9 7579857 missense probably damaging 1.00
R9188:Mmp27 UTSW 9 7579791 missense possibly damaging 0.55
R9280:Mmp27 UTSW 9 7579811 missense probably benign 0.09
R9367:Mmp27 UTSW 9 7573549 missense probably damaging 1.00
X0021:Mmp27 UTSW 9 7573298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCTCATTTAAATAAAGCTGGAGC -3'
(R):5'- TGAGTGTCACCACCTAGACC -3'

Sequencing Primer
(F):5'- TGGAGCACAGCACAATGTTAC -3'
(R):5'- ATGGCCAAGGACTCCCAGAG -3'
Posted On 2016-10-05