Incidental Mutation 'R5485:Crebbp'
ID432541
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 043046-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5485 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 4114913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1000 (D1000E)
Ref Sequence ENSEMBL: ENSMUSP00000146330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205344] [ENSMUST00000205765]
Predicted Effect probably benign
Transcript: ENSMUST00000023165
AA Change: D1038E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: D1038E

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205344
AA Change: D574E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205685
Predicted Effect probably benign
Transcript: ENSMUST00000205765
AA Change: D1000E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,378 V85D probably benign Het
Abcb8 A G 5: 24,400,161 N115S probably benign Het
Appl1 C A 14: 26,962,866 L75F probably damaging Het
Atp13a5 A G 16: 29,281,942 probably null Het
Atp2c2 T A 8: 119,753,062 probably null Het
Cfap54 T A 10: 93,029,117 I94F probably damaging Het
Clasp1 A G 1: 118,467,913 I194V possibly damaging Het
Ctdnep1 C T 11: 69,981,490 R3W possibly damaging Het
Dgkb T C 12: 38,127,364 V230A probably damaging Het
Duoxa2 T C 2: 122,299,152 F38L possibly damaging Het
Ecd T C 14: 20,338,205 S172G probably benign Het
Endog G T 2: 30,171,651 probably benign Het
Eqtn G A 4: 94,924,956 P131L possibly damaging Het
Gabbr1 T A 17: 37,056,875 S290T possibly damaging Het
Glt8d2 T A 10: 82,651,448 R319S possibly damaging Het
Gm16686 A G 4: 88,755,404 probably benign Het
Gm5709 A T 3: 59,635,562 noncoding transcript Het
Gm7381 T C 8: 3,842,161 noncoding transcript Het
Gorab T G 1: 163,386,302 D353A possibly damaging Het
Gstm1 A G 3: 108,017,404 L20P probably damaging Het
Hexim2 A G 11: 103,139,058 D312G probably benign Het
Hfm1 A G 5: 106,847,662 probably null Het
Mbd4 C A 6: 115,850,718 A66S probably benign Het
Mmp27 T A 9: 7,573,362 W152R probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mrps18b A T 17: 35,914,344 V102D probably damaging Het
Olfr1513 A T 14: 52,349,319 C242* probably null Het
Peg10 T A 6: 4,755,565 M47K probably benign Het
Plxnc1 T G 10: 94,922,742 Q364P probably benign Het
Psd A T 19: 46,316,089 probably null Het
Rims1 T G 1: 22,483,208 I470L possibly damaging Het
Sbsn T C 7: 30,753,117 V519A possibly damaging Het
Senp1 A G 15: 98,066,496 V279A probably benign Het
Sfxn5 T A 6: 85,332,600 probably benign Het
Slc6a13 T A 6: 121,336,073 M483K probably damaging Het
Slc6a21 G A 7: 45,282,542 probably null Het
Slco6c1 T C 1: 97,125,756 Y140C probably damaging Het
Spata32 A G 11: 103,209,296 S128P probably damaging Het
Spty2d1 G T 7: 46,997,885 T432K possibly damaging Het
Stx8 A G 11: 68,020,966 Q170R probably benign Het
Sytl3 G A 17: 6,715,480 V112I probably benign Het
Tdrkh A G 3: 94,428,712 I420V probably benign Het
Tmem117 T C 15: 95,094,830 V457A probably benign Het
Tpk1 T C 6: 43,665,812 probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Tsen54 A G 11: 115,815,222 E90G probably benign Het
Ugt1a2 A T 1: 88,201,246 M204L probably damaging Het
Vmn2r17 A T 5: 109,420,106 I32F probably benign Het
Xkr6 T C 14: 63,819,384 V248A unknown Het
Zfhx4 C A 3: 5,243,007 S431Y probably damaging Het
Zfp318 T A 17: 46,412,254 S1728T possibly damaging Het
Zfp563 T C 17: 33,089,566 probably benign Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 splice site probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
Intriguing UTSW 16 4180022 missense possibly damaging 0.83
Suggestive UTSW 16 4108127 missense probably damaging 1.00
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0126:Crebbp UTSW 16 4084063 missense possibly damaging 0.94
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
R7210:Crebbp UTSW 16 4084257 missense possibly damaging 0.95
R7568:Crebbp UTSW 16 4126489 missense probably benign 0.34
R7672:Crebbp UTSW 16 4084710 missense probably benign 0.06
R8145:Crebbp UTSW 16 4128525 missense probably benign 0.03
R8152:Crebbp UTSW 16 4085081 missense possibly damaging 0.95
R8374:Crebbp UTSW 16 4084311 missense probably damaging 0.99
R8392:Crebbp UTSW 16 4084281 missense possibly damaging 0.49
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCATTTCCAAAGGTAAAGC -3'
(R):5'- AGTGTCTTTGACTAAGGGAGC -3'

Sequencing Primer
(F):5'- AATCTTTGGTGTGGAAGCACAG -3'
(R):5'- TCTTTGACTAAGGGAGCACTCAGC -3'
Posted On2016-10-05