Incidental Mutation 'R5485:Gabbr1'
ID432546
Institutional Source Beutler Lab
Gene Symbol Gabbr1
Ensembl Gene ENSMUSG00000024462
Gene Namegamma-aminobutyric acid (GABA) B receptor, 1
SynonymsGABAB1, GABAbR1
MMRRC Submission 043046-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R5485 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37045966-37075067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37056875 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 290 (S290T)
Ref Sequence ENSEMBL: ENSMUSP00000134268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025338] [ENSMUST00000172792] [ENSMUST00000173823] [ENSMUST00000174347]
Predicted Effect probably benign
Transcript: ENSMUST00000025338
AA Change: S406T

PolyPhen 2 Score 0.244 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000025338
Gene: ENSMUSG00000024462
AA Change: S406T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 29 95 8.72e0 SMART
CCP 99 156 3.03e-10 SMART
Pfam:Peripla_BP_6 168 538 1.6e-23 PFAM
Pfam:ANF_receptor 186 542 4.3e-73 PFAM
Pfam:7tm_3 602 858 9.8e-49 PFAM
coiled coil region 877 922 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172792
AA Change: S290T

PolyPhen 2 Score 0.833 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134268
Gene: ENSMUSG00000024462
AA Change: S290T

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:Peripla_BP_6 52 428 7.8e-24 PFAM
Pfam:ANF_receptor 70 426 5.7e-68 PFAM
Pfam:7tm_3 484 743 1.1e-50 PFAM
coiled coil region 761 806 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173823
SMART Domains Protein: ENSMUSP00000133797
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 29 95 1.6e-6 PFAM
low complexity region 159 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174347
SMART Domains Protein: ENSMUSP00000134346
Gene: ENSMUSG00000024462

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 30 51 N/A INTRINSIC
Pfam:ANF_receptor 102 213 1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174866
Meta Mutation Damage Score 0.1412 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.6%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for gamma-aminobutyric acid (GABA), which is the main inhibitory neurotransmitter in the mammalian central nervous system. This receptor functions as a heterodimer with GABA(B) receptor 2. Defects in this gene may underlie brain disorders such as schizophrenia and epilepsy. Alternative splicing generates multiple transcript variants, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Phenotypes of null mice vary depending on strain background and allele. Homozygous null mice may display seizures, premature death, and abnormal nervous system electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A T 11: 23,517,378 V85D probably benign Het
Abcb8 A G 5: 24,400,161 N115S probably benign Het
Appl1 C A 14: 26,962,866 L75F probably damaging Het
Atp13a5 A G 16: 29,281,942 probably null Het
Atp2c2 T A 8: 119,753,062 probably null Het
Cfap54 T A 10: 93,029,117 I94F probably damaging Het
Clasp1 A G 1: 118,467,913 I194V possibly damaging Het
Crebbp A C 16: 4,114,913 D1000E probably benign Het
Ctdnep1 C T 11: 69,981,490 R3W possibly damaging Het
Dgkb T C 12: 38,127,364 V230A probably damaging Het
Duoxa2 T C 2: 122,299,152 F38L possibly damaging Het
Ecd T C 14: 20,338,205 S172G probably benign Het
Endog G T 2: 30,171,651 probably benign Het
Eqtn G A 4: 94,924,956 P131L possibly damaging Het
Glt8d2 T A 10: 82,651,448 R319S possibly damaging Het
Gm16686 A G 4: 88,755,404 probably benign Het
Gm5709 A T 3: 59,635,562 noncoding transcript Het
Gm7381 T C 8: 3,842,161 noncoding transcript Het
Gorab T G 1: 163,386,302 D353A possibly damaging Het
Gstm1 A G 3: 108,017,404 L20P probably damaging Het
Hexim2 A G 11: 103,139,058 D312G probably benign Het
Hfm1 A G 5: 106,847,662 probably null Het
Mbd4 C A 6: 115,850,718 A66S probably benign Het
Mmp27 T A 9: 7,573,362 W152R probably damaging Het
Mogat1 A G 1: 78,523,670 T124A probably benign Het
Mrps18b A T 17: 35,914,344 V102D probably damaging Het
Olfr1513 A T 14: 52,349,319 C242* probably null Het
Peg10 T A 6: 4,755,565 M47K probably benign Het
Plxnc1 T G 10: 94,922,742 Q364P probably benign Het
Psd A T 19: 46,316,089 probably null Het
Rims1 T G 1: 22,483,208 I470L possibly damaging Het
Sbsn T C 7: 30,753,117 V519A possibly damaging Het
Senp1 A G 15: 98,066,496 V279A probably benign Het
Sfxn5 T A 6: 85,332,600 probably benign Het
Slc6a13 T A 6: 121,336,073 M483K probably damaging Het
Slc6a21 G A 7: 45,282,542 probably null Het
Slco6c1 T C 1: 97,125,756 Y140C probably damaging Het
Spata32 A G 11: 103,209,296 S128P probably damaging Het
Spty2d1 G T 7: 46,997,885 T432K possibly damaging Het
Stx8 A G 11: 68,020,966 Q170R probably benign Het
Sytl3 G A 17: 6,715,480 V112I probably benign Het
Tdrkh A G 3: 94,428,712 I420V probably benign Het
Tmem117 T C 15: 95,094,830 V457A probably benign Het
Tpk1 T C 6: 43,665,812 probably benign Het
Trpc2 GTGTCCTA GTGTCCTATGTCCTA 7: 102,095,213 probably null Het
Tsen54 A G 11: 115,815,222 E90G probably benign Het
Ugt1a2 A T 1: 88,201,246 M204L probably damaging Het
Vmn2r17 A T 5: 109,420,106 I32F probably benign Het
Xkr6 T C 14: 63,819,384 V248A unknown Het
Zfhx4 C A 3: 5,243,007 S431Y probably damaging Het
Zfp318 T A 17: 46,412,254 S1728T possibly damaging Het
Zfp563 T C 17: 33,089,566 probably benign Het
Other mutations in Gabbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Gabbr1 APN 17 37048443 nonsense probably null
IGL01309:Gabbr1 APN 17 37048607 critical splice donor site probably null
IGL01413:Gabbr1 APN 17 37062706 missense possibly damaging 0.93
IGL01568:Gabbr1 APN 17 37070669 missense probably damaging 1.00
IGL01845:Gabbr1 APN 17 37048414 splice site probably benign
IGL02083:Gabbr1 APN 17 37070065 missense possibly damaging 0.84
IGL02302:Gabbr1 APN 17 37054797 missense probably damaging 1.00
IGL02430:Gabbr1 APN 17 37056308 nonsense probably null
IGL02533:Gabbr1 APN 17 37072147 missense probably damaging 1.00
IGL02810:Gabbr1 APN 17 37062762 missense probably damaging 1.00
H8562:Gabbr1 UTSW 17 37071949 missense probably damaging 1.00
PIT4449001:Gabbr1 UTSW 17 37056350 missense probably damaging 1.00
R0025:Gabbr1 UTSW 17 37067210 intron probably benign
R0420:Gabbr1 UTSW 17 37046762 missense possibly damaging 0.68
R0464:Gabbr1 UTSW 17 37050834 unclassified probably benign
R1306:Gabbr1 UTSW 17 37055990 splice site probably null
R1412:Gabbr1 UTSW 17 37054913 splice site probably null
R1495:Gabbr1 UTSW 17 37055940 missense possibly damaging 0.68
R1612:Gabbr1 UTSW 17 37070669 missense probably damaging 1.00
R1658:Gabbr1 UTSW 17 37047507 missense probably damaging 0.96
R1763:Gabbr1 UTSW 17 37054767 missense probably damaging 1.00
R1779:Gabbr1 UTSW 17 37054879 missense probably damaging 1.00
R1964:Gabbr1 UTSW 17 37048459 missense probably damaging 1.00
R1996:Gabbr1 UTSW 17 37069220 missense probably damaging 1.00
R2014:Gabbr1 UTSW 17 37056782 splice site probably null
R2255:Gabbr1 UTSW 17 37071866 missense probably damaging 1.00
R4299:Gabbr1 UTSW 17 37055900 nonsense probably null
R4458:Gabbr1 UTSW 17 37067775 critical splice acceptor site probably null
R4510:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4511:Gabbr1 UTSW 17 37069211 missense probably damaging 1.00
R4571:Gabbr1 UTSW 17 37054236 nonsense probably null
R4597:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.74
R5109:Gabbr1 UTSW 17 37072028 intron probably benign
R5119:Gabbr1 UTSW 17 37048438 missense probably damaging 0.99
R5227:Gabbr1 UTSW 17 37070066 missense possibly damaging 0.93
R5253:Gabbr1 UTSW 17 37055913 missense possibly damaging 0.87
R5443:Gabbr1 UTSW 17 37070756 missense probably damaging 1.00
R5839:Gabbr1 UTSW 17 37067868 missense probably damaging 1.00
R5976:Gabbr1 UTSW 17 37067862 missense probably damaging 1.00
R6156:Gabbr1 UTSW 17 37048427 missense probably benign 0.01
R6167:Gabbr1 UTSW 17 37063379 missense probably damaging 1.00
R6214:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6215:Gabbr1 UTSW 17 37069365 missense probably damaging 1.00
R6348:Gabbr1 UTSW 17 37056899 missense possibly damaging 0.94
R6721:Gabbr1 UTSW 17 37054192 missense probably damaging 0.98
R7028:Gabbr1 UTSW 17 37064737 nonsense probably null
R7317:Gabbr1 UTSW 17 37069413 missense probably damaging 1.00
R7786:Gabbr1 UTSW 17 37070063 missense probably damaging 0.98
R7793:Gabbr1 UTSW 17 37047501 missense probably benign 0.13
R7833:Gabbr1 UTSW 17 37056969 missense possibly damaging 0.88
R8110:Gabbr1 UTSW 17 37048583 missense probably benign 0.10
R8318:Gabbr1 UTSW 17 37062543 missense probably benign 0.23
X0010:Gabbr1 UTSW 17 37070780 missense probably damaging 0.99
Z1177:Gabbr1 UTSW 17 37048424 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- TCCTGATCTTTGATTCTTAAGGGAC -3'
(R):5'- TGACGCAAACAAGCTCAAGATG -3'

Sequencing Primer
(F):5'- TCTTTGATTCTTAAGGGACTAAACAG -3'
(R):5'- CTCAAGATGGGTACAGGCC -3'
Posted On2016-10-05