Incidental Mutation 'R5452:Gnb4'
ID432559
Institutional Source Beutler Lab
Gene Symbol Gnb4
Ensembl Gene ENSMUSG00000027669
Gene Nameguanine nucleotide binding protein (G protein), beta 4
Synonyms
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location32580332-32616585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32589845 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 188 (M188K)
Ref Sequence ENSEMBL: ENSMUSP00000121127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108234] [ENSMUST00000155737] [ENSMUST00000184130] [ENSMUST00000193050]
Predicted Effect probably benign
Transcript: ENSMUST00000108234
AA Change: M188K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103869
Gene: ENSMUSG00000027669
AA Change: M188K

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 2.26e-7 SMART
WD40 86 125 3.22e-3 SMART
WD40 132 170 1.11e-6 SMART
WD40 173 212 1.96e-7 SMART
WD40 215 254 9.16e-8 SMART
WD40 257 298 2.8e-3 SMART
WD40 301 340 1.44e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152901
Predicted Effect probably benign
Transcript: ENSMUST00000155737
AA Change: M188K

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121127
Gene: ENSMUSG00000027669
AA Change: M188K

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 2.26e-7 SMART
WD40 86 125 3.22e-3 SMART
WD40 132 170 1.11e-6 SMART
WD40 173 212 1.96e-7 SMART
WD40 215 254 9.16e-8 SMART
WD40 257 298 2.8e-3 SMART
WD40 301 340 1.44e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184130
SMART Domains Protein: ENSMUSP00000138886
Gene: ENSMUSG00000027669

DomainStartEndE-ValueType
coiled coil region 1 33 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192116
Predicted Effect probably benign
Transcript: ENSMUST00000193050
SMART Domains Protein: ENSMUSP00000141196
Gene: ENSMUSG00000027669

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
PDB:4KFM|B 18 68 8e-24 PDB
SCOP:d1g72a_ 36 68 4e-3 SMART
Blast:WD40 44 72 2e-11 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heterotrimeric guanine nucleotide-binding proteins (G proteins), which integrate signals between receptors and effector proteins, are composed of an alpha, a beta, and a gamma subunit. These subunits are encoded by families of related genes. This gene encodes a beta subunit. Beta subunits are important regulators of alpha subunits, as well as of certain signal transduction receptors and effectors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Gnb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00962:Gnb4 APN 3 32593169 missense probably benign 0.01
IGL02527:Gnb4 APN 3 32589866 missense probably benign 0.01
IGL02589:Gnb4 APN 3 32589849 missense probably damaging 1.00
IGL02640:Gnb4 APN 3 32591225 missense probably benign 0.09
IGL02966:Gnb4 APN 3 32585223 missense probably benign 0.19
IGL03225:Gnb4 APN 3 32587732 missense probably damaging 0.98
IGL03248:Gnb4 APN 3 32585175 missense probably damaging 1.00
R0619:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R0620:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R0621:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R1278:Gnb4 UTSW 3 32587737 missense probably damaging 1.00
R1661:Gnb4 UTSW 3 32590039 nonsense probably null
R1665:Gnb4 UTSW 3 32590039 nonsense probably null
R1970:Gnb4 UTSW 3 32598141 missense probably damaging 1.00
R4915:Gnb4 UTSW 3 32585087 utr 3 prime probably benign
R5618:Gnb4 UTSW 3 32591207 missense probably benign 0.04
R6603:Gnb4 UTSW 3 32585146 missense probably damaging 1.00
R7681:Gnb4 UTSW 3 32587753 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CAAGTTTGCTTAGCTCTCGC -3'
(R):5'- ACAAGTTCGGGAGACACGAC -3'

Sequencing Primer
(F):5'- CTCCTGAGCATTGAGAATCCAGG -3'
(R):5'- GGAGACACGACTTGGTAAGTTTATTC -3'
Posted On2016-10-06