Incidental Mutation 'R5452:Sema3c'
ID 432565
Institutional Source Beutler Lab
Gene Symbol Sema3c
Ensembl Gene ENSMUSG00000028780
Gene Name sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C
Synonyms Semae, 1110036B02Rik
MMRRC Submission 042848-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5452 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 17779814-17935266 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 17922068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030568]
AlphaFold Q62181
Predicted Effect probably null
Transcript: ENSMUST00000030568
SMART Domains Protein: ENSMUSP00000030568
Gene: ENSMUSG00000028780

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Sema 54 495 1.16e-200 SMART
PSI 513 565 2.87e-13 SMART
IG 577 662 7.08e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115271
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutation exhibit perinatal lethality, hypopigmentation and abnormal heart development. Mice homozygous for a knock-out allele exhibit prenatal lethality associated with heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 A T 8: 41,248,801 (GRCm39) I304F probably damaging Het
Adamts5 A G 16: 85,666,800 (GRCm39) probably benign Het
Akr1c6 A G 13: 4,504,544 (GRCm39) R132G probably benign Het
Ash1l T A 3: 88,892,183 (GRCm39) M1354K possibly damaging Het
C6 T C 15: 4,844,311 (GRCm39) I911T possibly damaging Het
Calm2 T C 17: 87,743,150 (GRCm39) probably null Het
Ccdc80 G A 16: 44,938,528 (GRCm39) R745Q probably damaging Het
Celsr3 T C 9: 108,721,233 (GRCm39) I2685T possibly damaging Het
Chkb T C 15: 89,313,788 (GRCm39) probably benign Het
Dennd5b T A 6: 148,943,011 (GRCm39) probably null Het
Dnah2 T C 11: 69,415,209 (GRCm39) Y175C probably damaging Het
Dnajc13 A G 9: 104,069,313 (GRCm39) S1154P probably benign Het
Ephb4 T C 5: 137,359,404 (GRCm39) S325P probably damaging Het
Fzd9 C T 5: 135,279,714 (GRCm39) R57H probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Gm9949 A G 18: 62,313,587 (GRCm39) probably benign Het
Gnb4 A T 3: 32,643,994 (GRCm39) M188K probably benign Het
Hr G T 14: 70,794,067 (GRCm39) G109V probably damaging Het
Lrp1b A G 2: 40,812,328 (GRCm39) S2426P probably damaging Het
Map2k4 A G 11: 65,610,413 (GRCm39) W88R probably damaging Het
Map4 C T 9: 109,866,851 (GRCm39) probably benign Het
Moxd2 C T 6: 40,859,048 (GRCm39) probably null Het
Mrgprx1 T C 7: 47,671,556 (GRCm39) I64V probably benign Het
Mtrex T C 13: 113,049,715 (GRCm39) S232G probably null Het
Or5p68 A C 7: 107,945,312 (GRCm39) I292S probably damaging Het
Padi2 T C 4: 140,659,382 (GRCm39) F229S probably benign Het
Pappa2 T C 1: 158,666,172 (GRCm39) N1136S probably benign Het
Pcdhb1 A T 18: 37,398,811 (GRCm39) N254I possibly damaging Het
Plcb2 A G 2: 118,548,727 (GRCm39) Y400H probably damaging Het
Plce1 A C 19: 38,608,926 (GRCm39) T412P probably benign Het
Prg4 T C 1: 150,331,519 (GRCm39) probably benign Het
Prkdc A G 16: 15,586,501 (GRCm39) N2510S possibly damaging Het
Psme4 T A 11: 30,741,168 (GRCm39) S107T probably benign Het
Resf1 C A 6: 149,230,611 (GRCm39) S1219* probably null Het
Rint1 G T 5: 23,999,363 (GRCm39) A51S probably benign Het
Rsad1 T A 11: 94,434,515 (GRCm39) R306S probably damaging Het
Sirt3 G A 7: 140,444,928 (GRCm39) T290I probably damaging Het
Spam1 G A 6: 24,800,731 (GRCm39) G490D probably benign Het
Speer4f2 C T 5: 17,581,498 (GRCm39) R147W possibly damaging Het
Sppl2c A T 11: 104,078,126 (GRCm39) I309L probably benign Het
Srxn1 G A 2: 151,947,799 (GRCm39) V66M probably damaging Het
St3gal4 C T 9: 34,964,752 (GRCm39) R152H probably damaging Het
Sv2c A T 13: 96,114,591 (GRCm39) F532I probably damaging Het
Tacc1 C A 8: 25,654,431 (GRCm39) K705N probably null Het
Tekt3 G T 11: 62,985,619 (GRCm39) S475I probably damaging Het
Tjap1 T C 17: 46,571,101 (GRCm39) T139A probably damaging Het
Tnfrsf8 T A 4: 145,019,214 (GRCm39) K207M possibly damaging Het
Tnn T C 1: 159,937,831 (GRCm39) T965A probably benign Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Trmt2a A G 16: 18,068,814 (GRCm39) H270R probably damaging Het
Ttc21a T C 9: 119,780,037 (GRCm39) L448P probably benign Het
Ttll4 C A 1: 74,718,480 (GRCm39) N110K probably benign Het
Ttn T A 2: 76,585,168 (GRCm39) I22042F probably damaging Het
Tut7 A G 13: 59,948,471 (GRCm39) Y215H probably damaging Het
Ubr1 A G 2: 120,698,783 (GRCm39) Y1595H possibly damaging Het
Unc45a G A 7: 79,978,787 (GRCm39) P621S probably damaging Het
Xrn2 A T 2: 146,866,633 (GRCm39) probably null Het
Other mutations in Sema3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Sema3c APN 5 17,899,858 (GRCm39) missense probably damaging 1.00
IGL01528:Sema3c APN 5 17,919,413 (GRCm39) missense probably benign
IGL01618:Sema3c APN 5 17,877,504 (GRCm39) missense probably damaging 1.00
IGL01730:Sema3c APN 5 17,916,434 (GRCm39) missense probably benign 0.01
IGL01762:Sema3c APN 5 17,899,849 (GRCm39) missense possibly damaging 0.81
IGL02049:Sema3c APN 5 17,926,923 (GRCm39) splice site probably benign
IGL02249:Sema3c APN 5 17,867,961 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,867,972 (GRCm39) missense probably damaging 1.00
IGL02657:Sema3c APN 5 17,781,866 (GRCm39) start codon destroyed possibly damaging 0.71
IGL03213:Sema3c APN 5 17,899,637 (GRCm39) splice site probably benign
PIT4651001:Sema3c UTSW 5 17,899,731 (GRCm39) missense probably benign 0.37
R0031:Sema3c UTSW 5 17,899,726 (GRCm39) missense probably damaging 1.00
R0558:Sema3c UTSW 5 17,919,413 (GRCm39) missense probably benign 0.00
R0964:Sema3c UTSW 5 17,926,907 (GRCm39) missense probably damaging 1.00
R1164:Sema3c UTSW 5 17,883,312 (GRCm39) missense probably benign 0.40
R1351:Sema3c UTSW 5 17,883,334 (GRCm39) missense possibly damaging 0.60
R1368:Sema3c UTSW 5 17,883,330 (GRCm39) missense possibly damaging 0.96
R1480:Sema3c UTSW 5 17,887,029 (GRCm39) missense possibly damaging 0.57
R1880:Sema3c UTSW 5 17,932,464 (GRCm39) nonsense probably null
R1916:Sema3c UTSW 5 17,932,399 (GRCm39) missense probably benign 0.06
R3934:Sema3c UTSW 5 17,886,938 (GRCm39) missense probably damaging 0.97
R4284:Sema3c UTSW 5 17,883,345 (GRCm39) missense probably benign 0.01
R4449:Sema3c UTSW 5 17,781,844 (GRCm39) start gained probably benign
R4545:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4546:Sema3c UTSW 5 17,899,770 (GRCm39) missense probably benign 0.01
R4660:Sema3c UTSW 5 17,877,511 (GRCm39) missense probably damaging 1.00
R4890:Sema3c UTSW 5 17,880,157 (GRCm39) missense probably benign 0.00
R4937:Sema3c UTSW 5 17,899,684 (GRCm39) missense probably benign 0.01
R5065:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5145:Sema3c UTSW 5 17,932,615 (GRCm39) missense possibly damaging 0.89
R5586:Sema3c UTSW 5 17,916,422 (GRCm39) missense probably damaging 0.99
R5811:Sema3c UTSW 5 17,880,188 (GRCm39) splice site probably null
R5886:Sema3c UTSW 5 17,886,984 (GRCm39) missense possibly damaging 0.90
R6120:Sema3c UTSW 5 17,932,630 (GRCm39) missense probably benign 0.00
R6191:Sema3c UTSW 5 17,858,804 (GRCm39) missense probably damaging 1.00
R6318:Sema3c UTSW 5 17,877,430 (GRCm39) missense probably damaging 0.96
R6416:Sema3c UTSW 5 17,781,959 (GRCm39) missense probably damaging 0.99
R6441:Sema3c UTSW 5 17,929,130 (GRCm39) missense possibly damaging 0.96
R6816:Sema3c UTSW 5 17,875,463 (GRCm39) missense probably benign 0.36
R7146:Sema3c UTSW 5 17,899,701 (GRCm39) missense probably benign 0.22
R7526:Sema3c UTSW 5 17,932,594 (GRCm39) missense possibly damaging 0.46
R7832:Sema3c UTSW 5 17,899,845 (GRCm39) missense probably damaging 0.99
R8034:Sema3c UTSW 5 17,932,480 (GRCm39) missense probably damaging 1.00
R8053:Sema3c UTSW 5 17,860,020 (GRCm39) missense probably benign 0.00
R8076:Sema3c UTSW 5 17,932,362 (GRCm39) missense probably benign 0.00
R8264:Sema3c UTSW 5 17,881,537 (GRCm39) intron probably benign
R8359:Sema3c UTSW 5 17,858,726 (GRCm39) missense possibly damaging 0.56
R8437:Sema3c UTSW 5 17,867,936 (GRCm39) missense probably damaging 0.99
R9174:Sema3c UTSW 5 17,868,039 (GRCm39) critical splice donor site probably null
R9295:Sema3c UTSW 5 17,932,495 (GRCm39) missense probably benign 0.09
R9477:Sema3c UTSW 5 17,921,981 (GRCm39) missense
R9599:Sema3c UTSW 5 17,919,452 (GRCm39) critical splice donor site probably null
R9702:Sema3c UTSW 5 17,858,828 (GRCm39) missense probably damaging 1.00
Z1176:Sema3c UTSW 5 17,932,517 (GRCm39) missense probably benign 0.04
Z1177:Sema3c UTSW 5 17,922,029 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCGTTCGTGCTGAAAGC -3'
(R):5'- GTTTTCCTGGACAGTTCAATGTTGC -3'

Sequencing Primer
(F):5'- CGTTCGTGCTGAAAGCTTTTTAAC -3'
(R):5'- CCTGGACAGTTCAATGTTGCTTAAG -3'
Posted On 2016-10-06