Incidental Mutation 'R5452:Olfr493'
ID432577
Institutional Source Beutler Lab
Gene Symbol Olfr493
Ensembl Gene ENSMUSG00000093980
Gene Nameolfactory receptor 493
SynonymsMOR204-35, GA_x6K02T2PBJ9-10676998-10676054
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108346035-108346979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108346105 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 292 (I292S)
Ref Sequence ENSEMBL: ENSMUSP00000079005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080106]
Predicted Effect probably damaging
Transcript: ENSMUST00000080106
AA Change: I292S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079005
Gene: ENSMUSG00000093980
AA Change: I292S

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-55 PFAM
Pfam:7tm_1 44 293 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Olfr493
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Olfr493 APN 7 108346949 missense probably benign 0.00
IGL02087:Olfr493 APN 7 108346966 missense probably benign
IGL02484:Olfr493 APN 7 108346606 missense probably damaging 1.00
IGL02961:Olfr493 APN 7 108346127 missense probably benign 0.08
IGL03379:Olfr493 APN 7 108346989 unclassified probably benign
PIT4486001:Olfr493 UTSW 7 108346322 missense possibly damaging 0.95
R0281:Olfr493 UTSW 7 108346914 missense probably benign 0.00
R0285:Olfr493 UTSW 7 108346499 missense probably benign 0.02
R1222:Olfr493 UTSW 7 108346106 missense probably damaging 1.00
R1912:Olfr493 UTSW 7 108346807 missense probably damaging 0.98
R4178:Olfr493 UTSW 7 108346558 missense probably benign 0.00
R5239:Olfr493 UTSW 7 108346646 missense probably benign 0.03
R5421:Olfr493 UTSW 7 108346975 missense probably benign 0.00
R6991:Olfr493 UTSW 7 108346088 missense possibly damaging 0.92
R7372:Olfr493 UTSW 7 108346496 missense probably benign 0.00
R7374:Olfr493 UTSW 7 108346888 missense probably damaging 1.00
R7571:Olfr493 UTSW 7 108346482 missense probably benign 0.00
X0025:Olfr493 UTSW 7 108346601 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGAGGCTTTAAAGACCATATAGTC -3'
(R):5'- GGTCATAGCCATTTCCTACACCTAC -3'

Sequencing Primer
(F):5'- CACATTGTACTAATACTCATGCTACC -3'
(R):5'- ATCCTGAAGATGCGCTCCACTG -3'
Posted On2016-10-06