Mutagenetix > Incidental Mutations

Incidental Mutation 'R5452:Dnajc13'

432582

Institutional Source

Beutler Lab

Gene Symbol

Dnajc13

Ensembl Gene

ENSMUSG00000032560

Gene Name

DnaJ heat shock protein family (Hsp40) member C13

Synonyms

LOC382100, D030002L11Rik, Rme8

MMRRC Submission

042848-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R5452 (G1)

Quality Score

212

Status

Not validated

Chromosome

Chromosomal Location

104151282-104262930 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104192114 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1154 (S1154P)

Ref Sequence

ENSEMBL: ENSMUSP00000035170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035170] [ENSMUST00000186788]

Predicted Effect

probably benign
Transcript: ENSMUST00000035170
AA Change: S1154P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000035170
Gene: ENSMUSG00000032560
AA Change: S1154P

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	832	843	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
Blast:ARM	927	963	6e-12	BLAST
Pfam:DUF4339	976	1020	1.5e-18	PFAM
Blast:ARM	1071	1110	5e-12	BLAST
DnaJ	1300	1358	5.69e-18	SMART
low complexity region	1417	1426	N/A	INTRINSIC
low complexity region	1813	1829	N/A	INTRINSIC
Blast:ARM	1843	1884	6e-8	BLAST
low complexity region	1968	1984	N/A	INTRINSIC
low complexity region	2006	2016	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185503

Predicted Effect

probably benign
Transcript: ENSMUST00000186788
AA Change: S1159P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000139804
Gene: ENSMUSG00000032560
AA Change: S1159P

Domain	Start	End	E-Value	Type
low complexity region	706	719	N/A	INTRINSIC
low complexity region	837	848	N/A	INTRINSIC
low complexity region	918	931	N/A	INTRINSIC
Blast:ARM	932	968	6e-12	BLAST
Pfam:DUF4339	980	1025	8.1e-14	PFAM
Blast:ARM	1076	1115	5e-12	BLAST
DnaJ	1305	1363	5.69e-18	SMART
low complexity region	1422	1431	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
Blast:ARM	1848	1889	6e-8	BLAST
low complexity region	1973	1989	N/A	INTRINSIC
low complexity region	2011	2021	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188592

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189103

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson's disease. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	A	6: 149,329,113	S1219*	probably null	Het
Adam20	A	T	8: 40,795,764	I304F	probably damaging	Het
Adamts5	A	G	16: 85,869,912		probably null	Het
Akr1c6	A	G	13: 4,454,545	R132G	probably benign	Het
Ash1l	T	A	3: 88,984,876	M1354K	possibly damaging	Het
C6	T	C	15: 4,814,829	I911T	possibly damaging	Het
Calm2	T	C	17: 87,435,722		probably null	Het
Ccdc80	G	A	16: 45,118,165	R745Q	probably damaging	Het
Celsr3	T	C	9: 108,844,034	I2685T	possibly damaging	Het
Chkb	T	C	15: 89,429,585		probably benign	Het
Dennd5b	T	A	6: 149,041,513		probably null	Het
Dnah2	T	C	11: 69,524,383	Y175C	probably damaging	Het
Ephb4	T	C	5: 137,361,142	S325P	probably damaging	Het
Fzd9	C	T	5: 135,250,860	R57H	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm9949	A	G	18: 62,180,516		probably benign	Het
Gnb4	A	T	3: 32,589,845	M188K	probably benign	Het
Hr	G	T	14: 70,556,627	G109V	probably damaging	Het
Lrp1b	A	G	2: 40,922,316	S2426P	probably damaging	Het
Map2k4	A	G	11: 65,719,587	W88R	probably damaging	Het
Map4	C	T	9: 110,037,783		probably benign	Het
Moxd2	C	T	6: 40,882,114		probably null	Het
Mrgprx1	T	C	7: 48,021,808	I64V	probably benign	Het
Olfr493	A	C	7: 108,346,105	I292S	probably damaging	Het
Padi2	T	C	4: 140,932,071	F229S	probably benign	Het
Pappa2	T	C	1: 158,838,602	N1136S	probably benign	Het
Pcdhb1	A	T	18: 37,265,758	N254I	possibly damaging	Het
Plcb2	A	G	2: 118,718,246	Y400H	probably damaging	Het
Plce1	A	C	19: 38,620,482	T412P	probably benign	Het
Prg4	T	C	1: 150,455,768		probably benign	Het
Prkdc	A	G	16: 15,768,637	N2510S	possibly damaging	Het
Psme4	T	A	11: 30,791,168	S107T	probably benign	Het
Rint1	G	T	5: 23,794,365	A51S	probably benign	Het
Rsad1	T	A	11: 94,543,689	R306S	probably damaging	Het
Sema3c	T	G	5: 17,717,070		probably null	Het
Sirt3	G	A	7: 140,865,015	T290I	probably damaging	Het
Skiv2l2	T	C	13: 112,913,181	S232G	probably null	Het
Spam1	G	A	6: 24,800,732	G490D	probably benign	Het
Speer4f2	C	T	5: 17,376,500	R147W	possibly damaging	Het
Sppl2c	A	T	11: 104,187,300	I309L	probably benign	Het
Srxn1	G	A	2: 152,105,879	V66M	probably damaging	Het
St3gal4	C	T	9: 35,053,456	R152H	probably damaging	Het
Sv2c	A	T	13: 95,978,083	F532I	probably damaging	Het
Tacc1	C	A	8: 25,164,415	K705N	probably null	Het
Tekt3	G	T	11: 63,094,793	S475I	probably damaging	Het
Tjap1	T	C	17: 46,260,175	T139A	probably damaging	Het
Tnfrsf8	T	A	4: 145,292,644	K207M	possibly damaging	Het
Tnn	T	C	1: 160,110,261	T965A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt2a	A	G	16: 18,250,950	H270R	probably damaging	Het
Ttc21a	T	C	9: 119,950,971	L448P	probably benign	Het
Ttll4	C	A	1: 74,679,321	N110K	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Ubr1	A	G	2: 120,868,302	Y1595H	possibly damaging	Het
Unc45a	G	A	7: 80,329,039	P621S	probably damaging	Het
Xrn2	A	T	2: 147,024,713		probably null	Het
Zcchc6	A	G	13: 59,800,657	Y215H	probably damaging	Het

Other mutations in Dnajc13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00743:Dnajc13	APN	9	104162780	missense	probably benign	0.15
IGL00754:Dnajc13	APN	9	104174498	nonsense	probably null
IGL00914:Dnajc13	APN	9	104212882	missense	possibly damaging	0.90
IGL01014:Dnajc13	APN	9	104203218	missense	probably damaging	1.00
IGL01077:Dnajc13	APN	9	104231021	missense	probably benign	0.11
IGL01137:Dnajc13	APN	9	104160490	missense	probably benign
IGL01305:Dnajc13	APN	9	104230637	splice site	probably null
IGL01707:Dnajc13	APN	9	104228979	missense	probably damaging	1.00
IGL01781:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL01868:Dnajc13	APN	9	104162745	missense	possibly damaging	0.83
IGL01950:Dnajc13	APN	9	104190432	missense	possibly damaging	0.85
IGL02102:Dnajc13	APN	9	104229009	missense	possibly damaging	0.78
IGL02350:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02357:Dnajc13	APN	9	104162359	missense	possibly damaging	0.82
IGL02470:Dnajc13	APN	9	104175747	missense	probably benign	0.17
IGL02888:Dnajc13	APN	9	104180062	splice site	probably benign
IGL03079:Dnajc13	APN	9	104212869	nonsense	probably null
IGL03179:Dnajc13	APN	9	104167435	missense	probably benign	0.42
IGL03293:Dnajc13	APN	9	104174426	missense	possibly damaging	0.64
PIT4142001:Dnajc13	UTSW	9	104238473	missense	probably damaging	0.96
R0323:Dnajc13	UTSW	9	104156892	missense	probably damaging	1.00
R0361:Dnajc13	UTSW	9	104167059	missense	probably benign	0.18
R0480:Dnajc13	UTSW	9	104200509	missense	probably damaging	0.98
R0558:Dnajc13	UTSW	9	104201952	critical splice acceptor site	probably null
R0707:Dnajc13	UTSW	9	104172582	missense	probably benign	0.12
R0831:Dnajc13	UTSW	9	104172612	missense	probably damaging	1.00
R1234:Dnajc13	UTSW	9	104214157	missense	possibly damaging	0.64
R1433:Dnajc13	UTSW	9	104180121	missense	probably damaging	1.00
R1463:Dnajc13	UTSW	9	104178940	missense	probably damaging	1.00
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1464:Dnajc13	UTSW	9	104214167	missense	probably benign	0.10
R1489:Dnajc13	UTSW	9	104231035	missense	possibly damaging	0.94
R1575:Dnajc13	UTSW	9	104156838	missense	probably benign	0.29
R1750:Dnajc13	UTSW	9	104221477	missense	probably damaging	0.98
R1903:Dnajc13	UTSW	9	104228937	missense	probably damaging	0.98
R2066:Dnajc13	UTSW	9	104221441	missense	probably benign	0.01
R2206:Dnajc13	UTSW	9	104203518	missense	probably damaging	1.00
R3160:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R3162:Dnajc13	UTSW	9	104219898	missense	possibly damaging	0.57
R4158:Dnajc13	UTSW	9	104190442	missense	probably damaging	0.96
R4460:Dnajc13	UTSW	9	104181063	missense	probably damaging	0.96
R4537:Dnajc13	UTSW	9	104186805	intron	probably benign
R4538:Dnajc13	UTSW	9	104186805	intron	probably benign
R4631:Dnajc13	UTSW	9	104190417	missense	probably damaging	1.00
R4662:Dnajc13	UTSW	9	104207758	missense	probably damaging	1.00
R4722:Dnajc13	UTSW	9	104213818	missense	probably benign
R4731:Dnajc13	UTSW	9	104186805	intron	probably benign
R4732:Dnajc13	UTSW	9	104186805	intron	probably benign
R4758:Dnajc13	UTSW	9	104172574	missense	probably damaging	1.00
R4801:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4802:Dnajc13	UTSW	9	104175727	missense	probably benign	0.16
R4928:Dnajc13	UTSW	9	104233638	missense	possibly damaging	0.93
R4944:Dnajc13	UTSW	9	104167387	unclassified	probably benign
R4979:Dnajc13	UTSW	9	104186723	missense	probably damaging	1.00
R5177:Dnajc13	UTSW	9	104230986	missense	probably benign	0.39
R5190:Dnajc13	UTSW	9	104174525	missense	probably benign	0.00
R5256:Dnajc13	UTSW	9	104203329	missense	possibly damaging	0.86
R5657:Dnajc13	UTSW	9	104228537	missense	probably damaging	1.00
R5752:Dnajc13	UTSW	9	104192774	splice site	probably null
R5789:Dnajc13	UTSW	9	104214188	missense	probably damaging	1.00
R5837:Dnajc13	UTSW	9	104176666	missense	possibly damaging	0.88
R5846:Dnajc13	UTSW	9	104190385	missense	probably damaging	0.99
R5982:Dnajc13	UTSW	9	104184615	missense	possibly damaging	0.77
R6189:Dnajc13	UTSW	9	104213886	missense	probably benign	0.12
R6355:Dnajc13	UTSW	9	104203270	missense	probably damaging	0.99
R6483:Dnajc13	UTSW	9	104207804	missense	probably damaging	0.96
R6613:Dnajc13	UTSW	9	104213877	missense	probably benign	0.07
R6962:Dnajc13	UTSW	9	104181009	missense	probably benign	0.02
R7048:Dnajc13	UTSW	9	104203414	critical splice donor site	probably null
R7101:Dnajc13	UTSW	9	104165022	missense	possibly damaging	0.92
R7304:Dnajc13	UTSW	9	104238514	missense	probably benign	0.00
R7353:Dnajc13	UTSW	9	104230031	missense	possibly damaging	0.89
R7366:Dnajc13	UTSW	9	104184706	missense	probably benign	0.43
R7528:Dnajc13	UTSW	9	104178965	missense	possibly damaging	0.65
R7635:Dnajc13	UTSW	9	104162367	missense	probably benign
R7673:Dnajc13	UTSW	9	104233692	missense	probably benign	0.09
X0017:Dnajc13	UTSW	9	104238478	missense	possibly damaging	0.90
X0028:Dnajc13	UTSW	9	104165018	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGGTTGTGATTTCAGTATCAGC -3'
(R):5'- CTTCGGGCCTTCAAATATGGATTTATG -3'

Sequencing Primer
(F):5'- CGGGTACTGCAAAGAATG -3'
(R):5'- TCAAATATGGATTTATGAGTTGCCC -3'

Posted On

2016-10-06