Mutagenetix > Incidental Mutation

Incidental Mutation 'R5452:Psme4'

432586

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

042848-MU

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5452 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30791168 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 107 (S107T)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231
AA Change: S107T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: S107T

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000154757
AA Change: S115T

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850
AA Change: S115T

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	A	6: 149,329,113	S1219*	probably null	Het
Adam20	A	T	8: 40,795,764	I304F	probably damaging	Het
Adamts5	A	G	16: 85,869,912		probably benign	Het
Akr1c6	A	G	13: 4,454,545	R132G	probably benign	Het
Ash1l	T	A	3: 88,984,876	M1354K	possibly damaging	Het
C6	T	C	15: 4,814,829	I911T	possibly damaging	Het
Calm2	T	C	17: 87,435,722		probably null	Het
Ccdc80	G	A	16: 45,118,165	R745Q	probably damaging	Het
Celsr3	T	C	9: 108,844,034	I2685T	possibly damaging	Het
Chkb	T	C	15: 89,429,585		probably benign	Het
Dennd5b	T	A	6: 149,041,513		probably null	Het
Dnah2	T	C	11: 69,524,383	Y175C	probably damaging	Het
Dnajc13	A	G	9: 104,192,114	S1154P	probably benign	Het
Ephb4	T	C	5: 137,361,142	S325P	probably damaging	Het
Fzd9	C	T	5: 135,250,860	R57H	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm9949	A	G	18: 62,180,516		probably benign	Het
Gnb4	A	T	3: 32,589,845	M188K	probably benign	Het
Hr	G	T	14: 70,556,627	G109V	probably damaging	Het
Lrp1b	A	G	2: 40,922,316	S2426P	probably damaging	Het
Map2k4	A	G	11: 65,719,587	W88R	probably damaging	Het
Map4	C	T	9: 110,037,783		probably benign	Het
Moxd2	C	T	6: 40,882,114		probably null	Het
Mrgprx1	T	C	7: 48,021,808	I64V	probably benign	Het
Olfr493	A	C	7: 108,346,105	I292S	probably damaging	Het
Padi2	T	C	4: 140,932,071	F229S	probably benign	Het
Pappa2	T	C	1: 158,838,602	N1136S	probably benign	Het
Pcdhb1	A	T	18: 37,265,758	N254I	possibly damaging	Het
Plcb2	A	G	2: 118,718,246	Y400H	probably damaging	Het
Plce1	A	C	19: 38,620,482	T412P	probably benign	Het
Prg4	T	C	1: 150,455,768		probably benign	Het
Prkdc	A	G	16: 15,768,637	N2510S	possibly damaging	Het
Rint1	G	T	5: 23,794,365	A51S	probably benign	Het
Rsad1	T	A	11: 94,543,689	R306S	probably damaging	Het
Sema3c	T	G	5: 17,717,070		probably null	Het
Sirt3	G	A	7: 140,865,015	T290I	probably damaging	Het
Skiv2l2	T	C	13: 112,913,181	S232G	probably null	Het
Spam1	G	A	6: 24,800,732	G490D	probably benign	Het
Speer4f2	C	T	5: 17,376,500	R147W	possibly damaging	Het
Sppl2c	A	T	11: 104,187,300	I309L	probably benign	Het
Srxn1	G	A	2: 152,105,879	V66M	probably damaging	Het
St3gal4	C	T	9: 35,053,456	R152H	probably damaging	Het
Sv2c	A	T	13: 95,978,083	F532I	probably damaging	Het
Tacc1	C	A	8: 25,164,415	K705N	probably null	Het
Tekt3	G	T	11: 63,094,793	S475I	probably damaging	Het
Tjap1	T	C	17: 46,260,175	T139A	probably damaging	Het
Tnfrsf8	T	A	4: 145,292,644	K207M	possibly damaging	Het
Tnn	T	C	1: 160,110,261	T965A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt2a	A	G	16: 18,250,950	H270R	probably damaging	Het
Ttc21a	T	C	9: 119,950,971	L448P	probably benign	Het
Ttll4	C	A	1: 74,679,321	N110K	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Ubr1	A	G	2: 120,868,302	Y1595H	possibly damaging	Het
Unc45a	G	A	7: 80,329,039	P621S	probably damaging	Het
Xrn2	A	T	2: 147,024,713		probably null	Het
Zcchc6	A	G	13: 59,800,657	Y215H	probably damaging	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGAGCACAATGGATGGATTTTATC -3'
(R):5'- AGTTTATACCCCATGGAGCAAAC -3'

Sequencing Primer
(F):5'- CACAATGGATGGATTTTATCGTGTG -3'
(R):5'- ACAAGTTGATCAAGAGACG -3'

Posted On

2016-10-06