Incidental Mutation 'R5452:Sv2c'
ID432593
Institutional Source Beutler Lab
Gene Symbol Sv2c
Ensembl Gene ENSMUSG00000051111
Gene Namesynaptic vesicle glycoprotein 2c
Synonyms4930527L09Rik
MMRRC Submission 042848-MU
Accession Numbers

Genbank: NM_029210; MGI: 1922459

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location95954594-96132577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 95978083 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 532 (F532I)
Ref Sequence ENSEMBL: ENSMUSP00000138317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161263] [ENSMUST00000182289]
Predicted Effect probably damaging
Transcript: ENSMUST00000161263
AA Change: F532I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124473
Gene: ENSMUSG00000051111
AA Change: F532I

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 117 428 9.1e-31 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 573 4.8e-12 PFAM
Pfam:MFS_1 564 725 1.5e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182180
Predicted Effect probably damaging
Transcript: ENSMUST00000182289
AA Change: F532I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138317
Gene: ENSMUSG00000051111
AA Change: F532I

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
Pfam:Sugar_tr 119 427 2.2e-30 PFAM
Pfam:MFS_1 154 470 5e-27 PFAM
Pfam:Pentapeptide_4 496 571 6.2e-15 PFAM
transmembrane domain 581 603 N/A INTRINSIC
transmembrane domain 610 632 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypoactivity and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Plce1 A C 19: 38,620,482 T412P probably benign Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Sv2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Sv2c APN 13 96048429 missense probably damaging 1.00
IGL01313:Sv2c APN 13 96088289 missense probably damaging 1.00
IGL02710:Sv2c APN 13 95989141 missense probably damaging 0.99
IGL02990:Sv2c APN 13 96088378 missense probably damaging 1.00
IGL03145:Sv2c APN 13 95989098 missense probably damaging 1.00
D4043:Sv2c UTSW 13 96088481 missense probably benign 0.27
R0390:Sv2c UTSW 13 96088708 missense probably benign
R0849:Sv2c UTSW 13 95989811 missense probably damaging 1.00
R0907:Sv2c UTSW 13 96088255 missense probably damaging 1.00
R1177:Sv2c UTSW 13 95989763 missense possibly damaging 0.79
R1840:Sv2c UTSW 13 95981844 missense probably benign 0.08
R1865:Sv2c UTSW 13 95976775 missense probably benign 0.29
R1959:Sv2c UTSW 13 95976645 missense probably damaging 1.00
R2440:Sv2c UTSW 13 96048576 missense probably damaging 1.00
R4007:Sv2c UTSW 13 95986833 splice site probably benign
R4197:Sv2c UTSW 13 95978128 missense probably damaging 1.00
R4697:Sv2c UTSW 13 95986018 missense possibly damaging 0.64
R4719:Sv2c UTSW 13 95986811 missense probably benign 0.21
R4822:Sv2c UTSW 13 95985949 missense probably damaging 1.00
R5237:Sv2c UTSW 13 95981883 missense possibly damaging 0.76
R5531:Sv2c UTSW 13 95961378 missense probably damaging 0.98
R5756:Sv2c UTSW 13 95985967 missense probably benign
R5982:Sv2c UTSW 13 95976063 nonsense probably null
R6220:Sv2c UTSW 13 95976626 missense probably damaging 1.00
R6511:Sv2c UTSW 13 96048525 missense probably benign 0.00
R6520:Sv2c UTSW 13 95986721 missense probably benign
R7001:Sv2c UTSW 13 95981953 missense probably benign 0.11
R7073:Sv2c UTSW 13 96088250 missense probably damaging 1.00
R7116:Sv2c UTSW 13 95976644 missense probably damaging 1.00
R7261:Sv2c UTSW 13 96088301 missense probably damaging 1.00
R7374:Sv2c UTSW 13 95989136 missense probably damaging 1.00
R7423:Sv2c UTSW 13 96048548 missense probably benign 0.03
R7626:Sv2c UTSW 13 95985943 missense probably benign 0.13
R7727:Sv2c UTSW 13 95976695 missense possibly damaging 0.89
R7767:Sv2c UTSW 13 95989715 missense probably damaging 1.00
R7818:Sv2c UTSW 13 95986820 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTCAAATCAACCAATACAGGG -3'
(R):5'- AGGGTGCTGCATCTCTAAATC -3'

Sequencing Primer
(F):5'- TCAACCAATACAGGGAAATCGTTC -3'
(R):5'- GGGTGCTGCATCTCTAAATCCATTAG -3'
Posted On2016-10-06