Mutagenetix > Incidental Mutations

Incidental Mutation 'R5452:Adamts5'

432604

Institutional Source

Beutler Lab

Gene Symbol

Adamts5

Ensembl Gene

ENSMUSG00000022894

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2)

Synonyms

9530092O11Rik, ADAM-TS5

MMRRC Submission

042848-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.198) question?

Stock #

R5452 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

85856173-85901828 bp(-) (GRCm38)

Type of Mutation

critical splice donor site

DNA Base Change (assembly)

A to G at 85869912 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023611 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023611]

AlphaFold

Q9R001

Predicted Effect

probably benign
Transcript: ENSMUST00000023611

SMART Domains

Protein: ENSMUSP00000023611
Gene: ENSMUSG00000022894

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	182	9.1e-18	PFAM
low complexity region	226	232	N/A	INTRINSIC
Pfam:Reprolysin_5	265	450	2.1e-16	PFAM
Pfam:Reprolysin_4	265	472	4.8e-14	PFAM
Pfam:Reprolysin	267	476	4.6e-26	PFAM
Pfam:Reprolysin_2	286	466	3.7e-13	PFAM
Pfam:Reprolysin_3	288	421	6.9e-17	PFAM
Blast:ACR	477	555	4e-15	BLAST
low complexity region	556	566	N/A	INTRINSIC
TSP1	570	622	6.04e-13	SMART
Pfam:ADAM_spacer1	732	852	1.7e-35	PFAM
TSP1	878	926	7.12e-2	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. Mice lacking the encoded protein are protected from surgery-induced osteoarthritis and antigen-induced arthritis. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit a significant reduction in cartilage degradation after induction of osteoarthritis whereas those homozygous for another show no affect. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	C	A	6: 149,329,113	S1219*	probably null	Het
Adam20	A	T	8: 40,795,764	I304F	probably damaging	Het
Akr1c6	A	G	13: 4,454,545	R132G	probably benign	Het
Ash1l	T	A	3: 88,984,876	M1354K	possibly damaging	Het
C6	T	C	15: 4,814,829	I911T	possibly damaging	Het
Calm2	T	C	17: 87,435,722		probably null	Het
Ccdc80	G	A	16: 45,118,165	R745Q	probably damaging	Het
Celsr3	T	C	9: 108,844,034	I2685T	possibly damaging	Het
Chkb	T	C	15: 89,429,585		probably benign	Het
Dennd5b	T	A	6: 149,041,513		probably null	Het
Dnah2	T	C	11: 69,524,383	Y175C	probably damaging	Het
Dnajc13	A	G	9: 104,192,114	S1154P	probably benign	Het
Ephb4	T	C	5: 137,361,142	S325P	probably damaging	Het
Fzd9	C	T	5: 135,250,860	R57H	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm9949	A	G	18: 62,180,516		probably benign	Het
Gnb4	A	T	3: 32,589,845	M188K	probably benign	Het
Hr	G	T	14: 70,556,627	G109V	probably damaging	Het
Lrp1b	A	G	2: 40,922,316	S2426P	probably damaging	Het
Map2k4	A	G	11: 65,719,587	W88R	probably damaging	Het
Map4	C	T	9: 110,037,783		probably benign	Het
Moxd2	C	T	6: 40,882,114		probably null	Het
Mrgprx1	T	C	7: 48,021,808	I64V	probably benign	Het
Olfr493	A	C	7: 108,346,105	I292S	probably damaging	Het
Padi2	T	C	4: 140,932,071	F229S	probably benign	Het
Pappa2	T	C	1: 158,838,602	N1136S	probably benign	Het
Pcdhb1	A	T	18: 37,265,758	N254I	possibly damaging	Het
Plcb2	A	G	2: 118,718,246	Y400H	probably damaging	Het
Plce1	A	C	19: 38,620,482	T412P	probably benign	Het
Prg4	T	C	1: 150,455,768		probably benign	Het
Prkdc	A	G	16: 15,768,637	N2510S	possibly damaging	Het
Psme4	T	A	11: 30,791,168	S107T	probably benign	Het
Rint1	G	T	5: 23,794,365	A51S	probably benign	Het
Rsad1	T	A	11: 94,543,689	R306S	probably damaging	Het
Sema3c	T	G	5: 17,717,070		probably null	Het
Sirt3	G	A	7: 140,865,015	T290I	probably damaging	Het
Skiv2l2	T	C	13: 112,913,181	S232G	probably null	Het
Spam1	G	A	6: 24,800,732	G490D	probably benign	Het
Speer4f2	C	T	5: 17,376,500	R147W	possibly damaging	Het
Sppl2c	A	T	11: 104,187,300	I309L	probably benign	Het
Srxn1	G	A	2: 152,105,879	V66M	probably damaging	Het
St3gal4	C	T	9: 35,053,456	R152H	probably damaging	Het
Sv2c	A	T	13: 95,978,083	F532I	probably damaging	Het
Tacc1	C	A	8: 25,164,415	K705N	probably null	Het
Tekt3	G	T	11: 63,094,793	S475I	probably damaging	Het
Tjap1	T	C	17: 46,260,175	T139A	probably damaging	Het
Tnfrsf8	T	A	4: 145,292,644	K207M	possibly damaging	Het
Tnn	T	C	1: 160,110,261	T965A	probably benign	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Trmt2a	A	G	16: 18,250,950	H270R	probably damaging	Het
Ttc21a	T	C	9: 119,950,971	L448P	probably benign	Het
Ttll4	C	A	1: 74,679,321	N110K	probably benign	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Ubr1	A	G	2: 120,868,302	Y1595H	possibly damaging	Het
Unc45a	G	A	7: 80,329,039	P621S	probably damaging	Het
Xrn2	A	T	2: 147,024,713		probably null	Het
Zcchc6	A	G	13: 59,800,657	Y215H	probably damaging	Het

Other mutations in Adamts5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01063:Adamts5	APN	16	85899834	missense	probably damaging	1.00
IGL01070:Adamts5	APN	16	85863133	missense	probably damaging	1.00
IGL01321:Adamts5	APN	16	85899475	missense	probably benign	0.03
IGL01616:Adamts5	APN	16	85887814	splice site	probably null
IGL02551:Adamts5	APN	16	85870038	missense	possibly damaging	0.71
IGL03263:Adamts5	APN	16	85869942	missense	probably damaging	0.99
IGL03295:Adamts5	APN	16	85877945	missense	probably damaging	1.00
IGL03393:Adamts5	APN	16	85868195	missense	probably damaging	0.99
IGL03403:Adamts5	APN	16	85863014	missense	probably damaging	0.97
R0414:Adamts5	UTSW	16	85877906	missense	probably damaging	1.00
R0419:Adamts5	UTSW	16	85866642	missense	probably benign	0.00
R0539:Adamts5	UTSW	16	85868692	missense	probably damaging	1.00
R0570:Adamts5	UTSW	16	85899247	missense	probably damaging	1.00
R0574:Adamts5	UTSW	16	85899484	missense	probably damaging	0.99
R0669:Adamts5	UTSW	16	85899726	missense	probably benign	0.45
R1454:Adamts5	UTSW	16	85869993	missense	possibly damaging	0.88
R1498:Adamts5	UTSW	16	85900102	missense	possibly damaging	0.63
R1729:Adamts5	UTSW	16	85877915	nonsense	probably null
R1753:Adamts5	UTSW	16	85899352	missense	probably damaging	1.00
R1784:Adamts5	UTSW	16	85877915	nonsense	probably null
R1906:Adamts5	UTSW	16	85868685	nonsense	probably null
R1946:Adamts5	UTSW	16	85899243	missense	probably damaging	1.00
R2180:Adamts5	UTSW	16	85887924	missense	probably damaging	1.00
R2223:Adamts5	UTSW	16	85899306	missense	probably damaging	1.00
R2366:Adamts5	UTSW	16	85862758	missense	probably damaging	1.00
R3889:Adamts5	UTSW	16	85868121	missense	probably damaging	1.00
R4214:Adamts5	UTSW	16	85868643	missense	probably damaging	1.00
R4909:Adamts5	UTSW	16	85900066	nonsense	probably null
R5119:Adamts5	UTSW	16	85899578	missense	probably benign	0.00
R5230:Adamts5	UTSW	16	85870068	missense	probably damaging	0.97
R5652:Adamts5	UTSW	16	85899268	missense	probably damaging	1.00
R5831:Adamts5	UTSW	16	85868118	missense	probably damaging	1.00
R6045:Adamts5	UTSW	16	85899300	missense	probably damaging	0.99
R6259:Adamts5	UTSW	16	85899753	missense	probably benign	0.03
R6384:Adamts5	UTSW	16	85862828	missense	probably benign	0.00
R6724:Adamts5	UTSW	16	85868557	missense	probably benign	0.06
R6829:Adamts5	UTSW	16	85870071	missense	possibly damaging	0.52
R7066:Adamts5	UTSW	16	85862764	missense	probably damaging	1.00
R7256:Adamts5	UTSW	16	85863035	missense	probably damaging	1.00
R7293:Adamts5	UTSW	16	85899945	missense	probably benign	0.10
R7298:Adamts5	UTSW	16	85899918	missense	probably benign	0.35
R7384:Adamts5	UTSW	16	85899826	missense	probably benign	0.02
R7452:Adamts5	UTSW	16	85877981	missense	probably benign	0.00
R7727:Adamts5	UTSW	16	85899966	missense	probably damaging	1.00
R7785:Adamts5	UTSW	16	85863004	missense	probably damaging	0.99
R7894:Adamts5	UTSW	16	85877920	nonsense	probably null
R8111:Adamts5	UTSW	16	85899315	missense	probably damaging	1.00
R8370:Adamts5	UTSW	16	85899993	missense	possibly damaging	0.74
R8413:Adamts5	UTSW	16	85866618	critical splice donor site	probably null
R8505:Adamts5	UTSW	16	85900056	missense	probably benign	0.42
R8804:Adamts5	UTSW	16	85869912	critical splice donor site	probably benign
R9209:Adamts5	UTSW	16	85870083	missense	probably damaging	1.00
X0062:Adamts5	UTSW	16	85863157	missense	probably damaging	1.00
Z1177:Adamts5	UTSW	16	85870074	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGAGTTTGCCAAGAAATCCCTG -3'
(R):5'- AGTGCAACTTGACATTTGGGC -3'

Sequencing Primer
(F):5'- GCCAAGAAATCCCTGTTACTTGTGTG -3'
(R):5'- CAACTTGACATTTGGGCCTGAGTAC -3'

Posted On

2016-10-06