Incidental Mutation 'R5452:Plce1'
ID432610
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Namephospholipase C, epsilon 1
Synonyms4933403A21Rik, PLCepsilon
MMRRC Submission 042848-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.608) question?
Stock #R5452 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location38481109-38785030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 38620482 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 412 (T412P)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481] [ENSMUST00000182999]
Predicted Effect probably benign
Transcript: ENSMUST00000169713
AA Change: T412P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: T412P

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182267
AA Change: T412P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: T412P

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182481
AA Change: T412P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: T412P

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182999
SMART Domains Protein: ENSMUSP00000138098
Gene: ENSMUSG00000024998

DomainStartEndE-ValueType
SCOP:d1bkds_ 4 62 2e-5 SMART
Blast:RasGEF 34 74 1e-21 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C A 6: 149,329,113 S1219* probably null Het
Adam20 A T 8: 40,795,764 I304F probably damaging Het
Adamts5 A G 16: 85,869,912 probably null Het
Akr1c6 A G 13: 4,454,545 R132G probably benign Het
Ash1l T A 3: 88,984,876 M1354K possibly damaging Het
C6 T C 15: 4,814,829 I911T possibly damaging Het
Calm2 T C 17: 87,435,722 probably null Het
Ccdc80 G A 16: 45,118,165 R745Q probably damaging Het
Celsr3 T C 9: 108,844,034 I2685T possibly damaging Het
Chkb T C 15: 89,429,585 probably benign Het
Dennd5b T A 6: 149,041,513 probably null Het
Dnah2 T C 11: 69,524,383 Y175C probably damaging Het
Dnajc13 A G 9: 104,192,114 S1154P probably benign Het
Ephb4 T C 5: 137,361,142 S325P probably damaging Het
Fzd9 C T 5: 135,250,860 R57H probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm9949 A G 18: 62,180,516 probably benign Het
Gnb4 A T 3: 32,589,845 M188K probably benign Het
Hr G T 14: 70,556,627 G109V probably damaging Het
Lrp1b A G 2: 40,922,316 S2426P probably damaging Het
Map2k4 A G 11: 65,719,587 W88R probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Moxd2 C T 6: 40,882,114 probably null Het
Mrgprx1 T C 7: 48,021,808 I64V probably benign Het
Olfr493 A C 7: 108,346,105 I292S probably damaging Het
Padi2 T C 4: 140,932,071 F229S probably benign Het
Pappa2 T C 1: 158,838,602 N1136S probably benign Het
Pcdhb1 A T 18: 37,265,758 N254I possibly damaging Het
Plcb2 A G 2: 118,718,246 Y400H probably damaging Het
Prg4 T C 1: 150,455,768 probably benign Het
Prkdc A G 16: 15,768,637 N2510S possibly damaging Het
Psme4 T A 11: 30,791,168 S107T probably benign Het
Rint1 G T 5: 23,794,365 A51S probably benign Het
Rsad1 T A 11: 94,543,689 R306S probably damaging Het
Sema3c T G 5: 17,717,070 probably null Het
Sirt3 G A 7: 140,865,015 T290I probably damaging Het
Skiv2l2 T C 13: 112,913,181 S232G probably null Het
Spam1 G A 6: 24,800,732 G490D probably benign Het
Speer4f2 C T 5: 17,376,500 R147W possibly damaging Het
Sppl2c A T 11: 104,187,300 I309L probably benign Het
Srxn1 G A 2: 152,105,879 V66M probably damaging Het
St3gal4 C T 9: 35,053,456 R152H probably damaging Het
Sv2c A T 13: 95,978,083 F532I probably damaging Het
Tacc1 C A 8: 25,164,415 K705N probably null Het
Tekt3 G T 11: 63,094,793 S475I probably damaging Het
Tjap1 T C 17: 46,260,175 T139A probably damaging Het
Tnfrsf8 T A 4: 145,292,644 K207M possibly damaging Het
Tnn T C 1: 160,110,261 T965A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trmt2a A G 16: 18,250,950 H270R probably damaging Het
Ttc21a T C 9: 119,950,971 L448P probably benign Het
Ttll4 C A 1: 74,679,321 N110K probably benign Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ubr1 A G 2: 120,868,302 Y1595H possibly damaging Het
Unc45a G A 7: 80,329,039 P621S probably damaging Het
Xrn2 A T 2: 147,024,713 probably null Het
Zcchc6 A G 13: 59,800,657 Y215H probably damaging Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
angel_food UTSW 19 38727013 splice site probably benign
heavenly UTSW 19 38777989 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38720996 missense probably damaging 1.00
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2103:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6317:Plce1 UTSW 19 38524530 nonsense probably null
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 unclassified probably null
R7034:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7036:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7037:Plce1 UTSW 19 38702017 missense probably damaging 1.00
R7069:Plce1 UTSW 19 38758940 missense probably damaging 1.00
R7180:Plce1 UTSW 19 38779785 missense probably damaging 1.00
R7189:Plce1 UTSW 19 38760137 missense probably damaging 0.97
R7227:Plce1 UTSW 19 38726902 missense probably benign 0.00
R7253:Plce1 UTSW 19 38698508 missense probably damaging 1.00
R7278:Plce1 UTSW 19 38779896 missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38701903 missense probably benign 0.02
R7422:Plce1 UTSW 19 38651885 missense probably damaging 1.00
R7557:Plce1 UTSW 19 38765404 missense probably benign 0.30
R7653:Plce1 UTSW 19 38749319 missense probably benign 0.20
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- GTTCAGGTTAATGCATGAGCGC -3'
(R):5'- AAGGCCACTTCTTGCTCCTAAAG -3'

Sequencing Primer
(F):5'- CGCAGAGCTCAAAGGTGTTTG -3'
(R):5'- GCTCCTAAAGATGTAGTTGCCTCTAG -3'
Posted On2016-10-06