Incidental Mutation 'R5453:Fam126a'
ID432618
Institutional Source Beutler Lab
Gene Symbol Fam126a
Ensembl Gene ENSMUSG00000028995
Gene Namefamily with sequence similarity 126, member A
Synonyms
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.674) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location23915276-24030690 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 23987879 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030849] [ENSMUST00000101513] [ENSMUST00000115109] [ENSMUST00000197617]
Predicted Effect probably null
Transcript: ENSMUST00000030849
SMART Domains Protein: ENSMUSP00000030849
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 22 330 2.7e-133 PFAM
low complexity region 353 373 N/A INTRINSIC
low complexity region 415 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101513
SMART Domains Protein: ENSMUSP00000099050
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 8e-141 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115109
SMART Domains Protein: ENSMUSP00000110761
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 20 330 2.2e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147179
Predicted Effect probably null
Transcript: ENSMUST00000197617
SMART Domains Protein: ENSMUSP00000143784
Gene: ENSMUSG00000028995

DomainStartEndE-ValueType
Pfam:Hyccin 1 248 1.7e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198867
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may play a part in the beta-catenin/Lef signaling pathway. Expression of this gene is down-regulated by beta-catenin. Defects in this gene are a cause of hypomyelination with congenital cataract (HCC). [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp108 G T 7: 24,261,264 G427W probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Fam126a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Fam126a APN 5 23985845 splice site probably benign
IGL03365:Fam126a APN 5 23983160 missense probably benign 0.30
Dropsy UTSW 5 23999958 missense probably damaging 0.99
R0070:Fam126a UTSW 5 23964999 missense probably damaging 1.00
R0070:Fam126a UTSW 5 23964999 missense probably damaging 1.00
R0616:Fam126a UTSW 5 23986772 missense probably damaging 0.99
R0645:Fam126a UTSW 5 23979508 missense probably damaging 1.00
R1364:Fam126a UTSW 5 23965353 missense probably benign
R1462:Fam126a UTSW 5 23985732 splice site probably benign
R1544:Fam126a UTSW 5 23965141 missense probably benign 0.00
R1670:Fam126a UTSW 5 23999991 start codon destroyed possibly damaging 0.95
R1796:Fam126a UTSW 5 23986151 missense probably damaging 1.00
R4433:Fam126a UTSW 5 23979581 missense possibly damaging 0.77
R4523:Fam126a UTSW 5 23965122 missense probably benign 0.01
R5220:Fam126a UTSW 5 23965222 missense possibly damaging 0.64
R5694:Fam126a UTSW 5 23991796 missense probably damaging 1.00
R5703:Fam126a UTSW 5 23980579 splice site probably null
R6144:Fam126a UTSW 5 23966369 missense possibly damaging 0.45
R6547:Fam126a UTSW 5 23965100 missense probably benign 0.04
R6579:Fam126a UTSW 5 23966383 missense possibly damaging 0.77
R6906:Fam126a UTSW 5 23999958 missense probably damaging 0.99
R6924:Fam126a UTSW 5 23986135 splice site probably null
R6959:Fam126a UTSW 5 23991756 missense possibly damaging 0.84
R7068:Fam126a UTSW 5 23964795 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CCAGCTTAAAGATGCACTTAAACAG -3'
(R):5'- CAGTTACTAGAGCCCGTGTG -3'

Sequencing Primer
(F):5'- TCAGGGCTACACTGTGAGAC -3'
(R):5'- GTTACTAGAGCCCGTGTGTCACC -3'
Posted On2016-10-06