Incidental Mutation 'R5453:Zfp108'
ID432626
Institutional Source Beutler Lab
Gene Symbol Zfp108
Ensembl Gene ENSMUSG00000030486
Gene Namezinc finger protein 108
Synonyms
MMRRC Submission 043017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R5453 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location24254794-24262445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 24261264 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 427 (G427W)
Ref Sequence ENSEMBL: ENSMUSP00000145928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072713] [ENSMUST00000205982] [ENSMUST00000206777]
Predicted Effect probably damaging
Transcript: ENSMUST00000072713
AA Change: G427W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072496
Gene: ENSMUSG00000030486
AA Change: G427W

DomainStartEndE-ValueType
KRAB 8 63 7.94e-18 SMART
low complexity region 140 153 N/A INTRINSIC
ZnF_C2H2 281 303 1.33e-1 SMART
ZnF_C2H2 309 331 1.69e-3 SMART
ZnF_C2H2 337 359 1.3e-4 SMART
ZnF_C2H2 365 387 2.71e-2 SMART
ZnF_C2H2 393 415 5.14e-3 SMART
ZnF_C2H2 421 443 1.87e-5 SMART
ZnF_C2H2 449 471 3.44e-4 SMART
ZnF_C2H2 477 497 1.08e1 SMART
ZnF_C2H2 503 525 3.89e-3 SMART
ZnF_C2H2 531 553 2.09e-3 SMART
ZnF_C2H2 559 581 4.61e-5 SMART
ZnF_C2H2 587 609 7.9e-4 SMART
ZnF_C2H2 615 637 1.67e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000205982
AA Change: G427W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000206777
AA Change: G427W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik A G 6: 50,595,796 probably null Het
Abca5 G A 11: 110,319,796 Q186* probably null Het
Adamts20 T C 15: 94,326,088 E1253G possibly damaging Het
Adgrd1 T C 5: 129,179,583 F640S probably damaging Het
Anxa1 C T 19: 20,380,339 probably null Het
Babam2 A G 5: 32,007,246 E288G probably damaging Het
Cd163 C T 6: 124,312,541 A406V probably damaging Het
Cdh13 A T 8: 119,198,967 D358V probably damaging Het
Cdk10 A G 8: 123,226,392 I45V probably benign Het
Crybg2 A T 4: 134,078,836 probably null Het
Dnhd1 A G 7: 105,710,123 D3555G probably damaging Het
Dync1h1 A G 12: 110,632,665 D1818G probably benign Het
Emsy T C 7: 98,600,806 K758R probably damaging Het
Fam126a A G 5: 23,987,879 probably null Het
Fat3 A G 9: 15,996,864 V2614A probably damaging Het
Hivep2 T C 10: 14,128,228 I190T possibly damaging Het
Hoxb3 T C 11: 96,344,654 S136P probably damaging Het
Hras A C 7: 141,192,855 V29G probably damaging Het
Igll1 A G 16: 16,863,694 probably null Het
Insr G A 8: 3,155,694 T1365I probably benign Het
Kitl T A 10: 100,087,385 W187R probably damaging Het
Klb T A 5: 65,383,385 F940L probably benign Het
Lrp1b C T 2: 41,282,237 R725K probably damaging Het
Map4 C T 9: 110,037,783 probably benign Het
Mrps35 A G 6: 147,070,617 S253G probably benign Het
Mycbp2 C T 14: 103,201,401 E2015K probably damaging Het
Nyap2 A C 1: 81,192,142 I205L probably benign Het
Olfr103 T C 17: 37,337,062 M57V possibly damaging Het
Olfr427 A G 1: 174,099,467 K3R probably benign Het
Rab11fip3 C T 17: 25,992,581 probably null Het
Rbm47 A G 5: 66,027,182 V26A probably benign Het
Ripk2 A T 4: 16,151,989 I190N probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ttc17 A T 2: 94,303,560 N1150K probably damaging Het
Zfp84 A G 7: 29,776,297 E138G possibly damaging Het
Other mutations in Zfp108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Zfp108 APN 7 24261486 missense possibly damaging 0.82
IGL01392:Zfp108 APN 7 24258447 splice site probably benign
R0123:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0126:Zfp108 UTSW 7 24260724 missense probably benign 0.01
R0134:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0243:Zfp108 UTSW 7 24261783 missense possibly damaging 0.81
R1227:Zfp108 UTSW 7 24260460 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1731:Zfp108 UTSW 7 24258539 missense possibly damaging 0.75
R1739:Zfp108 UTSW 7 24261310 missense probably damaging 1.00
R1751:Zfp108 UTSW 7 24261896 missense probably damaging 1.00
R3713:Zfp108 UTSW 7 24261845 nonsense probably null
R3839:Zfp108 UTSW 7 24260556 missense probably benign 0.01
R3919:Zfp108 UTSW 7 24260832 missense probably damaging 0.99
R3922:Zfp108 UTSW 7 24261348 missense probably damaging 1.00
R4707:Zfp108 UTSW 7 24260412 missense probably benign 0.08
R4912:Zfp108 UTSW 7 24261314 missense probably damaging 1.00
R4965:Zfp108 UTSW 7 24260148 missense probably benign
R4989:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5014:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5163:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5183:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5184:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5185:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5600:Zfp108 UTSW 7 24260586 missense probably benign 0.00
R6494:Zfp108 UTSW 7 24261357 missense probably damaging 1.00
R6601:Zfp108 UTSW 7 24261394 missense probably damaging 0.98
R6735:Zfp108 UTSW 7 24261772 missense probably damaging 1.00
R7646:Zfp108 UTSW 7 24261415 missense probably damaging 1.00
R7732:Zfp108 UTSW 7 24261527 missense probably benign 0.00
R7873:Zfp108 UTSW 7 24261333 missense probably benign 0.19
R7956:Zfp108 UTSW 7 24261333 missense probably benign 0.19
RF019:Zfp108 UTSW 7 24261607 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCACAGCTCAACTCTTCAG -3'
(R):5'- GGATTGAGGCCTGACGGAAC -3'

Sequencing Primer
(F):5'- GGCTTCACAAAGTGGGACCATC -3'
(R):5'- AGGCATGACTGAAGCCTTTC -3'
Posted On2016-10-06