Incidental Mutation 'R5454:Cope'
ID432673
Institutional Source Beutler Lab
Gene Symbol Cope
Ensembl Gene ENSMUSG00000055681
Gene Namecoatomer protein complex, subunit epsilon
Synonyms1110005D17Rik, Cope1
MMRRC Submission 043018-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R5454 (G1)
Quality Score199
Status Validated
Chromosome8
Chromosomal Location70302518-70312993 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70304656 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000130416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008004] [ENSMUST00000066469] [ENSMUST00000128003] [ENSMUST00000150968] [ENSMUST00000168018]
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066469
AA Change: V50A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000071078
Gene: ENSMUSG00000055681
AA Change: V50A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 305 2.8e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127076
Predicted Effect probably benign
Transcript: ENSMUST00000128003
SMART Domains Protein: ENSMUSP00000122888
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 212 5.4e-95 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect probably benign
Transcript: ENSMUST00000150968
AA Change: V50A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000119055
Gene: ENSMUSG00000055681
AA Change: V50A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 227 6.5e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167850
SMART Domains Protein: ENSMUSP00000132976
Gene: ENSMUSG00000055681

DomainStartEndE-ValueType
Pfam:Coatomer_E 1 79 5.4e-38 PFAM
Pfam:Coatomer_E 75 113 3.7e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168018
AA Change: V50A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130416
Gene: ENSMUSG00000055681
AA Change: V50A

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Coatomer_E 15 79 4.5e-22 PFAM
Meta Mutation Damage Score 0.0864 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an epsilon subunit of coatomer protein complex. Coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles. It is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins. Coatomer complex consists of at least the alpha, beta, beta', gamma, delta, epsilon and zeta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,168,988 noncoding transcript Het
Ankfy1 A T 11: 72,746,931 H483L probably benign Het
Ankrd46 C T 15: 36,479,301 G215R probably damaging Het
Apobec1 T C 6: 122,581,368 I143V probably benign Het
Atp2b4 C A 1: 133,729,872 V627F probably damaging Het
Ccdc80 T A 16: 45,127,225 Y855* probably null Het
Cd209b T C 8: 3,925,396 E88G probably damaging Het
Ceacam14 T G 7: 17,814,185 W67G probably damaging Het
Dcaf13 C A 15: 39,124,364 D168E probably benign Het
Dhcr7 T G 7: 143,837,839 M55R probably damaging Het
Enpp7 A T 11: 118,988,808 Y96F probably benign Het
Esco1 T C 18: 10,584,327 D60G probably benign Het
Fgfr3 G A 5: 33,723,298 probably benign Het
Frzb T C 2: 80,417,915 D280G probably damaging Het
Gcat A G 15: 79,036,410 I317V probably benign Het
Gm13030 A T 4: 138,873,509 probably benign Het
Gmds A G 13: 32,128,041 L135P probably damaging Het
Htra2 G A 6: 83,054,014 P138L probably damaging Het
Il5 A G 11: 53,723,799 N89S probably damaging Het
Ints3 G A 3: 90,408,527 T310M possibly damaging Het
Itih2 T C 2: 10,097,993 I777V probably null Het
Kctd9 T C 14: 67,740,387 L382S probably damaging Het
Lor A G 3: 92,081,482 S166P unknown Het
Mga T A 2: 119,903,329 N219K probably damaging Het
Mtmr4 A T 11: 87,611,042 R641* probably null Het
Muc6 C T 7: 141,648,813 A611T possibly damaging Het
Obox3-ps8 A T 17: 36,453,011 noncoding transcript Het
Olfr474 A T 7: 107,954,889 M83L probably benign Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pcdhga12 T A 18: 37,766,261 S49T possibly damaging Het
Pcdhgc3 A G 18: 37,808,496 D650G probably damaging Het
Pcmt1 A G 10: 7,640,745 V167A probably damaging Het
Pcnt A T 10: 76,389,547 probably null Het
Pcx G T 19: 4,602,476 V164F probably damaging Het
Plekhg4 T C 8: 105,376,113 probably null Het
Pmch A G 10: 88,091,845 E136G probably damaging Het
Prkar1a A G 11: 109,660,060 D80G probably benign Het
Ryr3 T C 2: 112,730,302 probably null Het
Slc10a7 T C 8: 78,686,624 S171P possibly damaging Het
Sox6 A T 7: 115,701,773 M153K possibly damaging Het
Srgap2 T C 1: 131,289,737 I946V probably benign Het
Strbp T C 2: 37,645,483 E71G probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tnrc18 T C 5: 142,771,691 D1025G unknown Het
Tnxb A G 17: 34,709,625 H2671R possibly damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Umodl1 A T 17: 30,986,465 D649V possibly damaging Het
Usp13 G T 3: 32,905,436 A559S probably damaging Het
Vps45 G A 3: 96,019,657 P526L probably benign Het
Zfp687 A G 3: 95,009,146 V855A probably damaging Het
Zfp771 T A 7: 127,254,276 C205S probably damaging Het
Other mutations in Cope
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02696:Cope APN 8 70310493 critical splice donor site probably null
PIT4431001:Cope UTSW 8 70312767 missense probably damaging 0.99
R0570:Cope UTSW 8 70306531 missense probably damaging 0.96
R1382:Cope UTSW 8 70312863 missense probably benign 0.00
R1518:Cope UTSW 8 70312761 missense possibly damaging 0.72
R4538:Cope UTSW 8 70306507 missense probably damaging 1.00
R4941:Cope UTSW 8 70302934 critical splice donor site probably null
R5106:Cope UTSW 8 70310447 missense possibly damaging 0.57
R5764:Cope UTSW 8 70306581 missense probably damaging 1.00
R5979:Cope UTSW 8 70302543 unclassified probably null
R6003:Cope UTSW 8 70304635 missense probably benign 0.01
R6010:Cope UTSW 8 70308512 missense probably damaging 1.00
R7074:Cope UTSW 8 70312887 missense probably benign 0.11
R8022:Cope UTSW 8 70312803 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCGCATCAGTTGAGAGAAGATC -3'
(R):5'- TAATGACGAAGCCAGGCATG -3'

Sequencing Primer
(F):5'- AGATCAGGGCTTTGCACACTG -3'
(R):5'- AAGCCTGATGACCTGAGTTC -3'
Posted On2016-10-06