Incidental Mutation 'R5454:Pcmt1'
ID432679
Institutional Source Beutler Lab
Gene Symbol Pcmt1
Ensembl Gene ENSMUSG00000019795
Gene Nameprotein-L-isoaspartate (D-aspartate) O-methyltransferase 1
SynonymsPIMT, protein carboxyl methyltransferase
MMRRC Submission 043018-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R5454 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location7629373-7681136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7640745 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 167 (V167A)
Ref Sequence ENSEMBL: ENSMUSP00000125144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159917] [ENSMUST00000161123] [ENSMUST00000162606] [ENSMUST00000162682] [ENSMUST00000163085]
Predicted Effect probably damaging
Transcript: ENSMUST00000159917
AA Change: V181A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124932
Gene: ENSMUSG00000019795
AA Change: V181A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 1.1e-88 PFAM
Pfam:Ubie_methyltran 126 258 3.4e-7 PFAM
Pfam:Methyltransf_31 134 284 1.1e-8 PFAM
Pfam:Methyltransf_18 136 241 3e-9 PFAM
Pfam:Methyltransf_11 141 239 1.5e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160250
Predicted Effect probably benign
Transcript: ENSMUST00000161123
SMART Domains Protein: ENSMUSP00000124100
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 53 108 4.2e-14 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000161428
AA Change: V104A
SMART Domains Protein: ENSMUSP00000123758
Gene: ENSMUSG00000019795
AA Change: V104A

DomainStartEndE-ValueType
Pfam:PCMT 1 160 2.7e-61 PFAM
Pfam:Ubie_methyltran 49 148 8.3e-7 PFAM
Pfam:Methyltransf_31 58 111 3.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162606
AA Change: V181A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123866
Gene: ENSMUSG00000019795
AA Change: V181A

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
Pfam:PCMT 66 279 2e-88 PFAM
Pfam:Ubie_methyltran 126 259 1e-6 PFAM
Pfam:Methyltransf_31 134 283 3.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162682
SMART Domains Protein: ENSMUSP00000124246
Gene: ENSMUSG00000019795

DomainStartEndE-ValueType
Pfam:PCMT 1 66 7.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163085
AA Change: V167A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125144
Gene: ENSMUSG00000019795
AA Change: V167A

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:PCMT 52 265 9.1e-89 PFAM
Pfam:Ubie_methyltran 112 244 3.1e-7 PFAM
Pfam:Methyltransf_31 120 270 9.8e-9 PFAM
Pfam:Methyltransf_18 122 227 2.7e-9 PFAM
Pfam:Methyltransf_11 127 225 1.4e-6 PFAM
Meta Mutation Damage Score 0.8310 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Homozygous disruption of this gene causes accumulation of modified proteins, growth retardation and fatal epileptic seizures. Homozygotes for one null allele also show a small spleen, altered lipid, hormone, mineral and enzyme profiles, kyphosis, enlarged brain and abnormal dendritic arborizations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,168,988 noncoding transcript Het
Ankfy1 A T 11: 72,746,931 H483L probably benign Het
Ankrd46 C T 15: 36,479,301 G215R probably damaging Het
Apobec1 T C 6: 122,581,368 I143V probably benign Het
Atp2b4 C A 1: 133,729,872 V627F probably damaging Het
Ccdc80 T A 16: 45,127,225 Y855* probably null Het
Cd209b T C 8: 3,925,396 E88G probably damaging Het
Ceacam14 T G 7: 17,814,185 W67G probably damaging Het
Cope T C 8: 70,304,656 V50A probably benign Het
Dcaf13 C A 15: 39,124,364 D168E probably benign Het
Dhcr7 T G 7: 143,837,839 M55R probably damaging Het
Enpp7 A T 11: 118,988,808 Y96F probably benign Het
Esco1 T C 18: 10,584,327 D60G probably benign Het
Fgfr3 G A 5: 33,723,298 probably benign Het
Frzb T C 2: 80,417,915 D280G probably damaging Het
Gcat A G 15: 79,036,410 I317V probably benign Het
Gm13030 A T 4: 138,873,509 probably benign Het
Gmds A G 13: 32,128,041 L135P probably damaging Het
Htra2 G A 6: 83,054,014 P138L probably damaging Het
Il5 A G 11: 53,723,799 N89S probably damaging Het
Ints3 G A 3: 90,408,527 T310M possibly damaging Het
Itih2 T C 2: 10,097,993 I777V probably null Het
Kctd9 T C 14: 67,740,387 L382S probably damaging Het
Lor A G 3: 92,081,482 S166P unknown Het
Mga T A 2: 119,903,329 N219K probably damaging Het
Mtmr4 A T 11: 87,611,042 R641* probably null Het
Muc6 C T 7: 141,648,813 A611T possibly damaging Het
Obox3-ps8 A T 17: 36,453,011 noncoding transcript Het
Olfr474 A T 7: 107,954,889 M83L probably benign Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pcdhga12 T A 18: 37,766,261 S49T possibly damaging Het
Pcdhgc3 A G 18: 37,808,496 D650G probably damaging Het
Pcnt A T 10: 76,389,547 probably null Het
Pcx G T 19: 4,602,476 V164F probably damaging Het
Plekhg4 T C 8: 105,376,113 probably null Het
Pmch A G 10: 88,091,845 E136G probably damaging Het
Prkar1a A G 11: 109,660,060 D80G probably benign Het
Ryr3 T C 2: 112,730,302 probably null Het
Slc10a7 T C 8: 78,686,624 S171P possibly damaging Het
Sox6 A T 7: 115,701,773 M153K possibly damaging Het
Srgap2 T C 1: 131,289,737 I946V probably benign Het
Strbp T C 2: 37,645,483 E71G probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tnrc18 T C 5: 142,771,691 D1025G unknown Het
Tnxb A G 17: 34,709,625 H2671R possibly damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Umodl1 A T 17: 30,986,465 D649V possibly damaging Het
Usp13 G T 3: 32,905,436 A559S probably damaging Het
Vps45 G A 3: 96,019,657 P526L probably benign Het
Zfp687 A G 3: 95,009,146 V855A probably damaging Het
Zfp771 T A 7: 127,254,276 C205S probably damaging Het
Other mutations in Pcmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02934:Pcmt1 APN 10 7640727 missense probably benign 0.00
R1968:Pcmt1 UTSW 10 7640710 nonsense probably null
R3889:Pcmt1 UTSW 10 7649050 critical splice donor site probably null
R5630:Pcmt1 UTSW 10 7649093 missense probably damaging 1.00
R5705:Pcmt1 UTSW 10 7638190 missense possibly damaging 0.86
R6667:Pcmt1 UTSW 10 7663149 missense probably damaging 1.00
R7163:Pcmt1 UTSW 10 7638158 missense probably benign 0.01
R7168:Pcmt1 UTSW 10 7638182 missense probably damaging 1.00
R7531:Pcmt1 UTSW 10 7680605 intron probably null
R8012:Pcmt1 UTSW 10 7640763 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCCGCTGAAATGGATGAGGG -3'
(R):5'- ACATGGACAGTTGTAAACAGTCAG -3'

Sequencing Primer
(F):5'- CTGAAATGGATGAGGGCTGCTG -3'
(R):5'- TTAGCCCTGTGGACTCTT -3'
Posted On2016-10-06