Mutagenetix > Incidental Mutations

Incidental Mutation 'R5454:Dcaf13'

432692

Institutional Source

Beutler Lab

Gene Symbol

Dcaf13

Ensembl Gene

ENSMUSG00000022300

Gene Name

DDB1 and CUL4 associated factor 13

Synonyms

LOC223499, Wdsof1

MMRRC Submission

043018-MU

Accession Numbers

Genbank: NM_198606; MGI: 2684929

Is this an essential gene?

Probably essential (E-score: 0.957) question?

Stock #

R5454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

39112865-39146856 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 39124364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 168 (D168E)

Ref Sequence

ENSEMBL: ENSMUSP00000022909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022909]

AlphaFold

Q6PAC3

Predicted Effect

probably benign
Transcript: ENSMUST00000022909
AA Change: D168E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022909
Gene: ENSMUSG00000022300
AA Change: D168E

Domain	Start	End	E-Value	Type
WD40	55	95	5.77e-5	SMART
WD40	98	137	4.38e-5	SMART
WD40	185	225	5.97e-1	SMART
Blast:WD40	228	267	1e-18	BLAST
WD40	271	310	2.69e-5	SMART
WD40	312	353	2.96e-2	SMART
Pfam:Sof1	354	440	7.2e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228436

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (60/60)

Allele List at MGI

All alleles(9) : Targeted, other(2) Gene trapped(7)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	T	C	9: 89,168,988		noncoding transcript	Het
Ankfy1	A	T	11: 72,746,931	H483L	probably benign	Het
Ankrd46	C	T	15: 36,479,301	G215R	probably damaging	Het
Apobec1	T	C	6: 122,581,368	I143V	probably benign	Het
Atp2b4	C	A	1: 133,729,872	V627F	probably damaging	Het
Ccdc80	T	A	16: 45,127,225	Y855*	probably null	Het
Cd209b	T	C	8: 3,925,396	E88G	probably damaging	Het
Ceacam14	T	G	7: 17,814,185	W67G	probably damaging	Het
Cope	T	C	8: 70,304,656	V50A	probably benign	Het
Dhcr7	T	G	7: 143,837,839	M55R	probably damaging	Het
Enpp7	A	T	11: 118,988,808	Y96F	probably benign	Het
Esco1	T	C	18: 10,584,327	D60G	probably benign	Het
Fgfr3	G	A	5: 33,723,298		probably benign	Het
Frzb	T	C	2: 80,417,915	D280G	probably damaging	Het
Gcat	A	G	15: 79,036,410	I317V	probably benign	Het
Gm13030	A	T	4: 138,873,509		probably benign	Het
Gmds	A	G	13: 32,128,041	L135P	probably damaging	Het
Htra2	G	A	6: 83,054,014	P138L	probably damaging	Het
Il5	A	G	11: 53,723,799	N89S	probably damaging	Het
Ints3	G	A	3: 90,408,527	T310M	possibly damaging	Het
Itih2	T	C	2: 10,097,993	I777V	probably null	Het
Kctd9	T	C	14: 67,740,387	L382S	probably damaging	Het
Lor	A	G	3: 92,081,482	S166P	unknown	Het
Mga	T	A	2: 119,903,329	N219K	probably damaging	Het
Mtmr4	A	T	11: 87,611,042	R641*	probably null	Het
Muc6	C	T	7: 141,648,813	A611T	possibly damaging	Het
Obox3-ps8	A	T	17: 36,453,011		noncoding transcript	Het
Olfr474	A	T	7: 107,954,889	M83L	probably benign	Het
Otud4	C	T	8: 79,651,042	L111F	possibly damaging	Het
Pcdhga12	T	A	18: 37,766,261	S49T	possibly damaging	Het
Pcdhgc3	A	G	18: 37,808,496	D650G	probably damaging	Het
Pcmt1	A	G	10: 7,640,745	V167A	probably damaging	Het
Pcnt	A	T	10: 76,389,547		probably null	Het
Pcx	G	T	19: 4,602,476	V164F	probably damaging	Het
Plekhg4	T	C	8: 105,376,113		probably null	Het
Pmch	A	G	10: 88,091,845	E136G	probably damaging	Het
Prkar1a	A	G	11: 109,660,060	D80G	probably benign	Het
Ryr3	T	C	2: 112,730,302		probably null	Het
Slc10a7	T	C	8: 78,686,624	S171P	possibly damaging	Het
Sox6	A	T	7: 115,701,773	M153K	possibly damaging	Het
Srgap2	T	C	1: 131,289,737	I946V	probably benign	Het
Strbp	T	C	2: 37,645,483	E71G	probably benign	Het
Synpo2l	C	A	14: 20,662,292	A87S	probably damaging	Het
Tnrc18	T	C	5: 142,771,691	D1025G	unknown	Het
Tnxb	A	G	17: 34,709,625	H2671R	possibly damaging	Het
Tor1b	GGACG	GG	2: 30,956,945		probably benign	Het
Umodl1	A	T	17: 30,986,465	D649V	possibly damaging	Het
Usp13	G	T	3: 32,905,436	A559S	probably damaging	Het
Vps45	G	A	3: 96,019,657	P526L	probably benign	Het
Zfp687	A	G	3: 95,009,146	V855A	probably damaging	Het
Zfp771	T	A	7: 127,254,276	C205S	probably damaging	Het

Other mutations in Dcaf13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00787:Dcaf13	APN	15	39143632	nonsense	probably null
IGL01081:Dcaf13	APN	15	39118806	missense	probably damaging	1.00
IGL01766:Dcaf13	APN	15	39118750	missense	probably benign	0.00
IGL02174:Dcaf13	APN	15	39138149	missense	probably damaging	1.00
IGL02262:Dcaf13	APN	15	39118707	splice site	probably benign
IGL02740:Dcaf13	APN	15	39145100	nonsense	probably null
IGL03092:Dcaf13	APN	15	39127976	splice site	probably benign
IGL03374:Dcaf13	APN	15	39145148	nonsense	probably null
R0590:Dcaf13	UTSW	15	39145085	splice site	probably benign
R0594:Dcaf13	UTSW	15	39123268	missense	probably benign	0.00
R0711:Dcaf13	UTSW	15	39138089	missense	probably damaging	1.00
R1036:Dcaf13	UTSW	15	39143718	missense	probably damaging	1.00
R1770:Dcaf13	UTSW	15	39130238	missense	probably damaging	1.00
R1826:Dcaf13	UTSW	15	39118899	missense	probably damaging	1.00
R1933:Dcaf13	UTSW	15	39138088	missense	probably damaging	0.99
R2508:Dcaf13	UTSW	15	39145152	missense	probably benign
R4113:Dcaf13	UTSW	15	39130220	missense	probably damaging	0.98
R4595:Dcaf13	UTSW	15	39118893	missense	probably damaging	1.00
R4649:Dcaf13	UTSW	15	39138242	missense	possibly damaging	0.54
R5431:Dcaf13	UTSW	15	39123224	missense	probably benign	0.16
R5834:Dcaf13	UTSW	15	39143642	nonsense	probably null
R5929:Dcaf13	UTSW	15	39143653	missense	possibly damaging	0.89
R5944:Dcaf13	UTSW	15	39146677	missense	probably benign
R6319:Dcaf13	UTSW	15	39143672	missense	probably benign	0.00
R6394:Dcaf13	UTSW	15	39143737	missense	probably benign	0.04
R6664:Dcaf13	UTSW	15	39118888	missense	probably damaging	1.00
R6884:Dcaf13	UTSW	15	39123240	missense	probably damaging	1.00
R7419:Dcaf13	UTSW	15	39130220	missense	probably damaging	0.98
R8750:Dcaf13	UTSW	15	39119441	missense	probably damaging	1.00
R8944:Dcaf13	UTSW	15	39138217	missense	possibly damaging	0.79
R9294:Dcaf13	UTSW	15	39130292	missense	possibly damaging	0.92
R9300:Dcaf13	UTSW	15	39146707	missense	probably damaging	1.00
Z1088:Dcaf13	UTSW	15	39145247	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAATTTGTAGCAAAATGTGGTGGG -3'
(R):5'- TGAGGAGCAGCTGAAATTTCAC -3'

Sequencing Primer
(F):5'- TTTGTAGCAAAATGTGGTGGGAGAAG -3'
(R):5'- GCCTGAAAACCTTACTAAATGCTAG -3'

Posted On

2016-10-06