Incidental Mutation 'R5454:Ccdc80'
ID432694
Institutional Source Beutler Lab
Gene Symbol Ccdc80
Ensembl Gene ENSMUSG00000022665
Gene Namecoiled-coil domain containing 80
SynonymsDRO1, Urb, Ssg1, 2610001E17Rik
MMRRC Submission 043018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R5454 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location45093402-45128077 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 45127225 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 855 (Y855*)
Ref Sequence ENSEMBL: ENSMUSP00000097097 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061050] [ENSMUST00000099498]
Predicted Effect probably null
Transcript: ENSMUST00000061050
AA Change: Y855*
SMART Domains Protein: ENSMUSP00000058752
Gene: ENSMUSG00000022665
AA Change: Y855*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 141 270 2.2e-31 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 614 748 3.1e-36 PFAM
Pfam:DUF4174 770 901 2.1e-36 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000099498
AA Change: Y855*
SMART Domains Protein: ENSMUSP00000097097
Gene: ENSMUSG00000022665
AA Change: Y855*

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DUF4174 140 271 8.9e-34 PFAM
low complexity region 294 308 N/A INTRINSIC
low complexity region 335 380 N/A INTRINSIC
low complexity region 482 497 N/A INTRINSIC
coiled coil region 554 587 N/A INTRINSIC
Pfam:DUF4174 613 749 1.4e-21 PFAM
Pfam:DUF4174 769 902 3.5e-39 PFAM
low complexity region 917 940 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (60/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased adiposity, hyperglycemia, glucose intolerance, impaired insulin secretion, and altered energy intake and expenditure when fed a high-fat diet. Mice homozygous for a different null allele develop thyroid adenomas and ovarian carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579C12Rik T C 9: 89,168,988 noncoding transcript Het
Ankfy1 A T 11: 72,746,931 H483L probably benign Het
Ankrd46 C T 15: 36,479,301 G215R probably damaging Het
Apobec1 T C 6: 122,581,368 I143V probably benign Het
Atp2b4 C A 1: 133,729,872 V627F probably damaging Het
Cd209b T C 8: 3,925,396 E88G probably damaging Het
Ceacam14 T G 7: 17,814,185 W67G probably damaging Het
Cope T C 8: 70,304,656 V50A probably benign Het
Dcaf13 C A 15: 39,124,364 D168E probably benign Het
Dhcr7 T G 7: 143,837,839 M55R probably damaging Het
Enpp7 A T 11: 118,988,808 Y96F probably benign Het
Esco1 T C 18: 10,584,327 D60G probably benign Het
Fgfr3 G A 5: 33,723,298 probably benign Het
Frzb T C 2: 80,417,915 D280G probably damaging Het
Gcat A G 15: 79,036,410 I317V probably benign Het
Gm13030 A T 4: 138,873,509 probably benign Het
Gmds A G 13: 32,128,041 L135P probably damaging Het
Htra2 G A 6: 83,054,014 P138L probably damaging Het
Il5 A G 11: 53,723,799 N89S probably damaging Het
Ints3 G A 3: 90,408,527 T310M possibly damaging Het
Itih2 T C 2: 10,097,993 I777V probably null Het
Kctd9 T C 14: 67,740,387 L382S probably damaging Het
Lor A G 3: 92,081,482 S166P unknown Het
Mga T A 2: 119,903,329 N219K probably damaging Het
Mtmr4 A T 11: 87,611,042 R641* probably null Het
Muc6 C T 7: 141,648,813 A611T possibly damaging Het
Obox3-ps8 A T 17: 36,453,011 noncoding transcript Het
Olfr474 A T 7: 107,954,889 M83L probably benign Het
Otud4 C T 8: 79,651,042 L111F possibly damaging Het
Pcdhga12 T A 18: 37,766,261 S49T possibly damaging Het
Pcdhgc3 A G 18: 37,808,496 D650G probably damaging Het
Pcmt1 A G 10: 7,640,745 V167A probably damaging Het
Pcnt A T 10: 76,389,547 probably null Het
Pcx G T 19: 4,602,476 V164F probably damaging Het
Plekhg4 T C 8: 105,376,113 probably null Het
Pmch A G 10: 88,091,845 E136G probably damaging Het
Prkar1a A G 11: 109,660,060 D80G probably benign Het
Ryr3 T C 2: 112,730,302 probably null Het
Slc10a7 T C 8: 78,686,624 S171P possibly damaging Het
Sox6 A T 7: 115,701,773 M153K possibly damaging Het
Srgap2 T C 1: 131,289,737 I946V probably benign Het
Strbp T C 2: 37,645,483 E71G probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tnrc18 T C 5: 142,771,691 D1025G unknown Het
Tnxb A G 17: 34,709,625 H2671R possibly damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Umodl1 A T 17: 30,986,465 D649V possibly damaging Het
Usp13 G T 3: 32,905,436 A559S probably damaging Het
Vps45 G A 3: 96,019,657 P526L probably benign Het
Zfp687 A G 3: 95,009,146 V855A probably damaging Het
Zfp771 T A 7: 127,254,276 C205S probably damaging Het
Other mutations in Ccdc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Ccdc80 APN 16 45096264 missense probably benign 0.07
IGL01781:Ccdc80 APN 16 45126130 missense probably damaging 1.00
IGL01945:Ccdc80 APN 16 45118245 missense probably damaging 0.99
IGL02163:Ccdc80 APN 16 45096114 missense probably benign
IGL02223:Ccdc80 APN 16 45095603 missense probably damaging 1.00
IGL02573:Ccdc80 APN 16 45095589 missense probably damaging 1.00
IGL02675:Ccdc80 APN 16 45116332 missense probably damaging 1.00
IGL02689:Ccdc80 APN 16 45096409 nonsense probably null
R0219:Ccdc80 UTSW 16 45096483 missense probably damaging 1.00
R0383:Ccdc80 UTSW 16 45095369 missense probably damaging 1.00
R1537:Ccdc80 UTSW 16 45095936 missense probably benign 0.21
R1726:Ccdc80 UTSW 16 45096005 missense probably benign 0.04
R1885:Ccdc80 UTSW 16 45096720 missense probably benign 0.09
R2021:Ccdc80 UTSW 16 45122912 missense probably damaging 1.00
R2140:Ccdc80 UTSW 16 45127446 missense probably damaging 1.00
R2186:Ccdc80 UTSW 16 45118105 missense probably damaging 1.00
R3896:Ccdc80 UTSW 16 45096621 missense probably benign 0.11
R3941:Ccdc80 UTSW 16 45096092 missense probably benign
R3971:Ccdc80 UTSW 16 45095820 missense probably benign 0.22
R4082:Ccdc80 UTSW 16 45122927 missense probably damaging 1.00
R4322:Ccdc80 UTSW 16 45095588 missense probably damaging 1.00
R4578:Ccdc80 UTSW 16 45095486 missense probably damaging 1.00
R4604:Ccdc80 UTSW 16 45095565 missense probably damaging 1.00
R4868:Ccdc80 UTSW 16 45104413 missense probably damaging 1.00
R4896:Ccdc80 UTSW 16 45095898 missense probably benign
R4921:Ccdc80 UTSW 16 45118167 missense probably damaging 1.00
R4979:Ccdc80 UTSW 16 45116287 missense possibly damaging 0.90
R5452:Ccdc80 UTSW 16 45118165 missense probably damaging 1.00
R5594:Ccdc80 UTSW 16 45116263 missense probably benign 0.00
R5661:Ccdc80 UTSW 16 45127445 missense probably damaging 1.00
R5701:Ccdc80 UTSW 16 45116378 missense possibly damaging 0.51
R6106:Ccdc80 UTSW 16 45096710 missense probably benign 0.00
R6393:Ccdc80 UTSW 16 45096465 missense possibly damaging 0.88
R6633:Ccdc80 UTSW 16 45094908 missense possibly damaging 0.95
R6943:Ccdc80 UTSW 16 45095082 missense probably benign 0.00
R7021:Ccdc80 UTSW 16 45104441 missense probably damaging 1.00
R7030:Ccdc80 UTSW 16 45122889 missense possibly damaging 0.60
R7208:Ccdc80 UTSW 16 45096710 missense probably benign 0.12
R7486:Ccdc80 UTSW 16 45126179 missense probably damaging 1.00
R7490:Ccdc80 UTSW 16 45096400 missense probably damaging 1.00
R7539:Ccdc80 UTSW 16 45095082 missense probably benign 0.01
R7562:Ccdc80 UTSW 16 45122903 missense probably damaging 1.00
X0012:Ccdc80 UTSW 16 45096425 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCTATTTGGACACTCCTAGC -3'
(R):5'- GCATACTCATCTTCTGGGCAGC -3'

Sequencing Primer
(F):5'- CCTAGCAAACAACTGGCTTTTG -3'
(R):5'- ATCTTCTGGGCAGCGCATC -3'
Posted On2016-10-06