Incidental Mutation 'R5455:Tor1b'
ID432702
Institutional Source Beutler Lab
Gene Symbol Tor1b
Ensembl Gene ENSMUSG00000026848
Gene Nametorsin family 1, member B
Synonyms2610016F05Rik, torsinB, DQ1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R5455 (G1)
Quality Score217
Status Not validated
Chromosome2
Chromosomal Location30952959-30959015 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) GGACG to GG at 30956945 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028199] [ENSMUST00000028200] [ENSMUST00000135507] [ENSMUST00000156711]
Predicted Effect probably benign
Transcript: ENSMUST00000028199
SMART Domains Protein: ENSMUSP00000028199
Gene: ENSMUSG00000026848

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
AAA 101 244 1.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028200
SMART Domains Protein: ENSMUSP00000028200
Gene: ENSMUSG00000026849

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Torsin 45 170 3.2e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123762
Predicted Effect probably benign
Transcript: ENSMUST00000132514
SMART Domains Protein: ENSMUSP00000117612
Gene: ENSMUSG00000026848

DomainStartEndE-ValueType
Pfam:Torsin 1 51 2.1e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133544
Predicted Effect probably benign
Transcript: ENSMUST00000135507
SMART Domains Protein: ENSMUSP00000117888
Gene: ENSMUSG00000026848

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Torsin 51 163 7.5e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155213
Predicted Effect probably benign
Transcript: ENSMUST00000156711
SMART Domains Protein: ENSMUSP00000120415
Gene: ENSMUSG00000026848

DomainStartEndE-ValueType
Pfam:Torsin 1 100 1.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195010
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ATPase found primarily in the endoplasmic reticulum and nuclear envelope. This gene has a highly-similar neighboring gene, TOR1A, that encodes a protein that is likely to interact in a complex with this protein. Finally, this protein may act as a chaperone and play a role in maintaining the integrity of the nuclear envelope and endoplasmic reticulum. Several transcript variants, some protein-coding and others non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Tor1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02881:Tor1b APN 2 30953853 nonsense probably null
R0666:Tor1b UTSW 2 30953913 missense probably damaging 0.97
R0866:Tor1b UTSW 2 30956916 missense probably benign 0.34
R1449:Tor1b UTSW 2 30955881 missense probably damaging 0.99
R1962:Tor1b UTSW 2 30956919 missense probably benign 0.21
R2411:Tor1b UTSW 2 30955812 missense probably damaging 0.99
R4087:Tor1b UTSW 2 30956519 missense probably damaging 1.00
R4868:Tor1b UTSW 2 30956577 critical splice donor site probably null
R5454:Tor1b UTSW 2 30956945 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TTGAGGGCACATGTCACTTG -3'
(R):5'- TCCATGACAAGGCCTGGAAC -3'

Sequencing Primer
(F):5'- TCTCTGGAAGGGTGAAGGC -3'
(R):5'- AACGGGGTGGGAGGTTCC -3'
Posted On2016-10-06