Incidental Mutation 'R5455:Gm10306'
ID432707
Institutional Source Beutler Lab
Gene Symbol Gm10306
Ensembl Gene ENSMUSG00000070900
Gene Namepredicted gene 10306
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.253) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location94556546-94557078 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to G at 94556840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030313] [ENSMUST00000094969]
Predicted Effect probably benign
Transcript: ENSMUST00000030313
SMART Domains Protein: ENSMUSP00000030313
Gene: ENSMUSG00000028578

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 33 58 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
Pfam:CAAP1 113 175 3.2e-31 PFAM
low complexity region 254 271 N/A INTRINSIC
coiled coil region 276 303 N/A INTRINSIC
low complexity region 331 337 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000094969
AA Change: W99G
SMART Domains Protein: ENSMUSP00000092576
Gene: ENSMUSG00000070900
AA Change: W99G

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153294
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Gm10306
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0027:Gm10306 UTSW 4 94556790 utr 5 prime probably benign
R1017:Gm10306 UTSW 4 94556720 start gained probably benign
R4872:Gm10306 UTSW 4 94556832 unclassified probably benign
R5335:Gm10306 UTSW 4 94556807 unclassified probably benign
R7234:Gm10306 UTSW 4 94556795 missense unknown
Predicted Primers PCR Primer
(F):5'- CGCTTTTCTCGGGAAGACTTC -3'
(R):5'- TGCTCAAATGAGGTCGTAGTG -3'

Sequencing Primer
(F):5'- GAAGACTTCTTCCCCGTCATGG -3'
(R):5'- TATCGTTGAATCAAACGAGGGAATC -3'
Posted On2016-10-06