Incidental Mutation 'R5455:Nop2'
ID432711
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125140643 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 424 (I424T)
Ref Sequence ENSEMBL: ENSMUSP00000047123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000117675] [ENSMUST00000119527] [ENSMUST00000144364]
Predicted Effect probably benign
Transcript: ENSMUST00000044200
AA Change: I424T

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: I424T

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1068:Nop2 UTSW 6 125132279 missense probably damaging 0.99
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R2100:Nop2 UTSW 6 125140822 missense probably damaging 1.00
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5010:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6065:Nop2 UTSW 6 125144565 missense probably benign
R6352:Nop2 UTSW 6 125137207 missense probably benign
R6436:Nop2 UTSW 6 125137311 missense probably benign 0.01
R7393:Nop2 UTSW 6 125133546 nonsense probably null
R7499:Nop2 UTSW 6 125144208 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CTGTCTGGGCAGAAAGGAGTTG -3'
(R):5'- GCATCCAGTAGCACTCGATC -3'

Sequencing Primer
(F):5'- AAGGAGTTGGCCTTGGAGG -3'
(R):5'- TCCAGTAGCACTCGATCAAAGC -3'
Posted On2016-10-06