Incidental Mutation 'R5455:Kcnn4'
ID432713
Institutional Source Beutler Lab
Gene Symbol Kcnn4
Ensembl Gene ENSMUSG00000054342
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
SynonymsKCa3.1, IK1, SK4, IKCa1, mIKCa1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5455 (G1)
Quality Score207
Status Not validated
Chromosome7
Chromosomal Location24370263-24386690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24377553 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 176 (S176P)
Ref Sequence ENSEMBL: ENSMUSP00000146012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171904] [ENSMUST00000205428] [ENSMUST00000205626]
Predicted Effect probably damaging
Transcript: ENSMUST00000171904
AA Change: S176P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133065
Gene: ENSMUSG00000054342
AA Change: S176P

DomainStartEndE-ValueType
Pfam:SK_channel 11 124 1.7e-41 PFAM
low complexity region 143 160 N/A INTRINSIC
Pfam:Ion_trans_2 209 289 2.6e-16 PFAM
CaMBD 302 375 1.85e-32 SMART
low complexity region 411 424 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205428
AA Change: S176P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000205626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205881
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice have increased parotid gland weight and both sexes have impaired volume regulation in erythrocytes and T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Kcnn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Kcnn4 APN 7 24381703 missense probably benign 0.05
IGL02958:Kcnn4 APN 7 24374745 missense probably benign 0.00
ivanhoe UTSW 7 24374742 missense probably damaging 1.00
longbow UTSW 7 24379255 missense possibly damaging 0.88
R0009:Kcnn4 UTSW 7 24379255 missense possibly damaging 0.88
R1706:Kcnn4 UTSW 7 24374742 missense probably damaging 1.00
R4300:Kcnn4 UTSW 7 24377604 missense probably benign 0.21
R4402:Kcnn4 UTSW 7 24377442 missense probably benign 0.12
R5811:Kcnn4 UTSW 7 24377605 missense probably damaging 0.99
R6319:Kcnn4 UTSW 7 24381740 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCATGACTGACAACGGGCTC -3'
(R):5'- CCATCATATCCAGTAGCCTCTG -3'

Sequencing Primer
(F):5'- AGGTGGCGCAGATCCTG -3'
(R):5'- AGTAGCCTCTGGTGTCTCC -3'
Posted On2016-10-06