Incidental Mutation 'R5455:Olfm5'
ID432717
Institutional Source Beutler Lab
Gene Symbol Olfm5
Ensembl Gene ENSMUSG00000044265
Gene Nameolfactomedin 5
SynonymsE030002O03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104153013-104164831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104154462 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 265 (R265G)
Ref Sequence ENSEMBL: ENSMUSP00000052174 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051137] [ENSMUST00000059121] [ENSMUST00000154555]
Predicted Effect probably damaging
Transcript: ENSMUST00000051137
AA Change: R265G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052174
Gene: ENSMUSG00000044265
AA Change: R265G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 85 N/A INTRINSIC
coiled coil region 157 198 N/A INTRINSIC
OLF 211 468 3.13e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059121
SMART Domains Protein: ENSMUSP00000056365
Gene: ENSMUSG00000051437

DomainStartEndE-ValueType
UBQ 31 101 5.13e-16 SMART
Blast:STI1 199 237 8e-11 BLAST
low complexity region 339 350 N/A INTRINSIC
low complexity region 402 419 N/A INTRINSIC
PDB:2DNA|A 561 610 3e-26 PDB
Blast:UBA 568 604 1e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154555
AA Change: R190G

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117893
Gene: ENSMUSG00000044265
AA Change: R190G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 47 123 N/A INTRINSIC
OLF 136 304 3.65e-10 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Olfm5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01843:Olfm5 APN 7 104160744 missense possibly damaging 0.77
IGL02097:Olfm5 APN 7 104154231 missense probably benign 0.20
IGL02322:Olfm5 APN 7 104154401 missense probably damaging 1.00
IGL02324:Olfm5 APN 7 104154095 unclassified probably null
IGL02702:Olfm5 APN 7 104154357 missense probably damaging 1.00
R0128:Olfm5 UTSW 7 104160926 missense probably benign
R0400:Olfm5 UTSW 7 104154179 missense probably damaging 1.00
R0600:Olfm5 UTSW 7 104153869 nonsense probably null
R0610:Olfm5 UTSW 7 104154445 nonsense probably null
R0699:Olfm5 UTSW 7 104154119 missense probably damaging 1.00
R1960:Olfm5 UTSW 7 104160412 missense possibly damaging 0.85
R1978:Olfm5 UTSW 7 104164741 missense unknown
R2391:Olfm5 UTSW 7 104160834 missense probably benign 0.00
R3774:Olfm5 UTSW 7 104161849 missense possibly damaging 0.67
R4632:Olfm5 UTSW 7 104160893 missense probably benign 0.00
R4770:Olfm5 UTSW 7 104160478 missense probably benign 0.04
R4838:Olfm5 UTSW 7 104154365 missense probably damaging 1.00
R5274:Olfm5 UTSW 7 104159983 missense probably damaging 1.00
R5930:Olfm5 UTSW 7 104154155 missense probably damaging 1.00
R6416:Olfm5 UTSW 7 104154053 missense probably damaging 1.00
R7126:Olfm5 UTSW 7 104159980 missense probably damaging 1.00
R7535:Olfm5 UTSW 7 104154237 missense possibly damaging 0.92
R7682:Olfm5 UTSW 7 104161772 missense probably null 0.49
R7835:Olfm5 UTSW 7 104154445 nonsense probably null
R7918:Olfm5 UTSW 7 104154445 nonsense probably null
X0011:Olfm5 UTSW 7 104153946 missense possibly damaging 0.91
Z1088:Olfm5 UTSW 7 104154150 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGCACTAGGGTGTTAG -3'
(R):5'- TAAATGCCATATGAGACTTCCCA -3'

Sequencing Primer
(F):5'- CACTAGGGTGTTAGAGGAAAGGTCC -3'
(R):5'- ATGTACACATCTTTAGGGCTGACCG -3'
Posted On2016-10-06