Incidental Mutation 'R5455:Dnajb12'
ID432722
Institutional Source Beutler Lab
Gene Symbol Dnajb12
Ensembl Gene ENSMUSG00000020109
Gene NameDnaJ heat shock protein family (Hsp40) member B12
SynonymsmDj10
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5455 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location59879556-59899302 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to G at 59892752 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020309] [ENSMUST00000131810] [ENSMUST00000142819] [ENSMUST00000146590] [ENSMUST00000147914]
Predicted Effect probably null
Transcript: ENSMUST00000020309
SMART Domains Protein: ENSMUSP00000020309
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131810
SMART Domains Protein: ENSMUSP00000116244
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
SCOP:d1a17__ 2 40 4e-3 SMART
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000142819
SMART Domains Protein: ENSMUSP00000118088
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000146590
SMART Domains Protein: ENSMUSP00000122056
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 262 370 2.8e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147914
SMART Domains Protein: ENSMUSP00000116577
Gene: ENSMUSG00000020109

DomainStartEndE-ValueType
low complexity region 57 80 N/A INTRINSIC
low complexity region 81 94 N/A INTRINSIC
DnaJ 110 167 3.18e-30 SMART
low complexity region 231 244 N/A INTRINSIC
Pfam:DUF1977 263 369 9.2e-31 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Dnajb12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02616:Dnajb12 APN 10 59892863 splice site probably null
IGL03412:Dnajb12 APN 10 59890073 missense probably benign 0.44
PIT4382001:Dnajb12 UTSW 10 59892686 missense probably damaging 1.00
R0496:Dnajb12 UTSW 10 59879801 nonsense probably null
R1692:Dnajb12 UTSW 10 59896377 missense probably damaging 1.00
R2087:Dnajb12 UTSW 10 59890845 missense possibly damaging 0.82
R2276:Dnajb12 UTSW 10 59892977 missense probably benign 0.31
R4110:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4113:Dnajb12 UTSW 10 59894314 missense possibly damaging 0.78
R4365:Dnajb12 UTSW 10 59879766 missense probably damaging 1.00
R4382:Dnajb12 UTSW 10 59897499 missense probably benign
R4757:Dnajb12 UTSW 10 59892770 missense probably benign
R5156:Dnajb12 UTSW 10 59892960 missense probably damaging 1.00
R5484:Dnajb12 UTSW 10 59892752 frame shift probably null
R5486:Dnajb12 UTSW 10 59892752 frame shift probably null
R5487:Dnajb12 UTSW 10 59892752 frame shift probably null
R5504:Dnajb12 UTSW 10 59892752 frame shift probably null
R5506:Dnajb12 UTSW 10 59892752 frame shift probably null
R5507:Dnajb12 UTSW 10 59892752 frame shift probably null
R5560:Dnajb12 UTSW 10 59892752 frame shift probably null
R5561:Dnajb12 UTSW 10 59892752 frame shift probably null
R5601:Dnajb12 UTSW 10 59892752 frame shift probably null
R5603:Dnajb12 UTSW 10 59892752 frame shift probably null
R5604:Dnajb12 UTSW 10 59892752 frame shift probably null
R6013:Dnajb12 UTSW 10 59894341 critical splice donor site probably null
R6724:Dnajb12 UTSW 10 59892780 missense possibly damaging 0.92
R6935:Dnajb12 UTSW 10 59896503 critical splice donor site probably null
R8044:Dnajb12 UTSW 10 59896350 missense possibly damaging 0.88
R8073:Dnajb12 UTSW 10 59890179 nonsense probably null
X0022:Dnajb12 UTSW 10 59892976 missense probably null 0.00
Z1088:Dnajb12 UTSW 10 59890054 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTAGCCTTGCCTAGAGGTGC -3'
(R):5'- CATGAACGTTACCTGAAACATGGAG -3'

Sequencing Primer
(F):5'- TCTGGATTGCCTGCCCAACAG -3'
(R):5'- TTACCTGAAACATGGAGATAGAGTC -3'
Posted On2016-10-06