Incidental Mutation 'R5455:4930452B06Rik'
ID432728
Institutional Source Beutler Lab
Gene Symbol 4930452B06Rik
Ensembl Gene ENSMUSG00000021747
Gene NameRIKEN cDNA 4930452B06 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location8431192-8666240 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 8536516 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000100061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102996]
Predicted Effect probably null
Transcript: ENSMUST00000102996
SMART Domains Protein: ENSMUSP00000100061
Gene: ENSMUSG00000021747

DomainStartEndE-ValueType
Pfam:DUF667 1 188 1.7e-43 PFAM
low complexity region 344 358 N/A INTRINSIC
low complexity region 506 519 N/A INTRINSIC
low complexity region 568 578 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225744
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in 4930452B06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:4930452B06Rik APN 14 8473370 missense possibly damaging 0.57
IGL02010:4930452B06Rik APN 14 8578384 missense possibly damaging 0.68
IGL02385:4930452B06Rik APN 14 8510920 missense possibly damaging 0.59
IGL02431:4930452B06Rik APN 14 8659424 missense probably damaging 1.00
IGL02723:4930452B06Rik APN 14 8516507 missense probably benign 0.02
IGL02865:4930452B06Rik APN 14 8517940 missense probably benign 0.00
IGL03030:4930452B06Rik APN 14 8511113 missense probably damaging 1.00
IGL03204:4930452B06Rik APN 14 8644436 missense possibly damaging 0.68
IGL03014:4930452B06Rik UTSW 14 8431608 makesense probably null
R0197:4930452B06Rik UTSW 14 8518695 missense probably damaging 1.00
R0265:4930452B06Rik UTSW 14 8431667 missense probably damaging 1.00
R0513:4930452B06Rik UTSW 14 8536609 missense probably damaging 1.00
R0647:4930452B06Rik UTSW 14 8536655 missense possibly damaging 0.94
R1168:4930452B06Rik UTSW 14 8442939 missense probably benign 0.22
R1610:4930452B06Rik UTSW 14 8511110 missense probably benign 0.00
R1625:4930452B06Rik UTSW 14 8431668 missense probably damaging 1.00
R2010:4930452B06Rik UTSW 14 8511021 missense probably damaging 1.00
R2084:4930452B06Rik UTSW 14 8558171 missense probably damaging 1.00
R2174:4930452B06Rik UTSW 14 8558109 missense probably benign 0.02
R3802:4930452B06Rik UTSW 14 8510931 missense probably benign 0.00
R4244:4930452B06Rik UTSW 14 8482521 missense probably benign 0.00
R4471:4930452B06Rik UTSW 14 8536571 missense probably damaging 1.00
R4516:4930452B06Rik UTSW 14 8536609 missense probably damaging 1.00
R4824:4930452B06Rik UTSW 14 8665997 start codon destroyed probably null 0.93
R4884:4930452B06Rik UTSW 14 8578394 missense probably damaging 0.97
R4975:4930452B06Rik UTSW 14 8518736 missense probably benign 0.00
R6280:4930452B06Rik UTSW 14 8473414 critical splice acceptor site probably null
R6438:4930452B06Rik UTSW 14 8431701 missense probably damaging 0.98
R6639:4930452B06Rik UTSW 14 8536530 missense probably benign 0.12
R7101:4930452B06Rik UTSW 14 8511171 missense possibly damaging 0.75
R7456:4930452B06Rik UTSW 14 8442933 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAATGCTCACATGCCAAGTTC -3'
(R):5'- AGTTTGCTTAGTTGGCAGCAAG -3'

Sequencing Primer
(F):5'- CTCACATGCCAAGTTCTTTATGTAGG -3'
(R):5'- CAAGGGCTTGCATTTGGGG -3'
Posted On2016-10-06