Incidental Mutation 'R5455:Morc2b'
ID432736
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33138610 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 63 (M63L)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably benign
Transcript: ENSMUST00000053896
AA Change: M63L

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: M63L

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131954
AA Change: M63L

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: M63L

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Ercc3 T C 18: 32,267,209 S705P possibly damaging Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0629:Morc2b UTSW 17 33135807 missense probably benign 0.00
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
R7754:Morc2b UTSW 17 33137244 missense probably benign 0.33
R7756:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7758:Morc2b UTSW 17 33137007 missense probably damaging 1.00
R7766:Morc2b UTSW 17 33138423 missense probably benign 0.19
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Z1177:Morc2b UTSW 17 33137402 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCTCATGAAAGGTTCGAGAC -3'
(R):5'- ATTACAGCACTCTCAACCGG -3'

Sequencing Primer
(F):5'- GGCAACTCATGGTGTTTTCTTTC -3'
(R):5'- ACCGGGCTCAACTAACCTTTG -3'
Posted On2016-10-06