Incidental Mutation 'R5455:Ercc3'
ID432740
Institutional Source Beutler Lab
Gene Symbol Ercc3
Ensembl Gene ENSMUSG00000024382
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 3
SynonymsXPB
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5455 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location32240300-32270151 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32267209 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 705 (S705P)
Ref Sequence ENSEMBL: ENSMUSP00000025241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025241
AA Change: S705P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025241
Gene: ENSMUSG00000024382
AA Change: S705P

DomainStartEndE-ValueType
low complexity region 3 28 N/A INTRINSIC
Pfam:Helicase_C_3 76 203 1.2e-46 PFAM
DEXDc 313 493 2.52e-18 SMART
HELICc 570 648 4.32e-8 SMART
low complexity region 707 716 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142213
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ATP-dependent DNA helicase that functions in nucleotide excision repair. The encoded protein is a subunit of basal transcription factor 2 (TFIIH) and, therefore, also functions in class II transcription. Mutations in this gene are associated with Xeroderma pigmentosum B, Cockayne's syndrome, and trichothiodystrophy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a frame shift mutation in exon 15 exhibit embryonic lethality prior to E8.5. Mice homozygous for a frame shift mutation following by a stop codon insertion in exon 15 exhibit increased sensitivity to ultraviolet- and gamma-irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A T 14: 8,536,516 probably null Het
Adgrf1 T A 17: 43,321,143 probably null Het
Ascc3 T C 10: 50,849,583 V2134A probably benign Het
Cct6b T G 11: 82,755,117 I80L probably benign Het
Crebbp C A 16: 4,085,967 V1765L probably benign Het
Cul9 C T 17: 46,510,846 probably null Het
Cyp2c40 A G 19: 39,803,792 I236T possibly damaging Het
Dbndd2 C A 2: 164,490,193 T112K possibly damaging Het
Dmrtc2 A C 7: 24,872,491 S4R probably benign Het
Dnah6 C T 6: 73,075,734 V2988I probably benign Het
Dnajb12 GC G 10: 59,892,752 probably null Het
Gm10306 T G 4: 94,556,840 probably benign Het
H2-Q6 T C 17: 35,424,884 L3P unknown Het
Kcnn4 T C 7: 24,377,553 S176P probably damaging Het
Maml2 T A 9: 13,705,743 Y128* probably null Het
Map2 G A 1: 66,399,391 E25K probably damaging Het
Morc2b T A 17: 33,138,610 M63L probably benign Het
Mthfd1 A G 12: 76,301,288 I569V probably benign Het
Myh8 G A 11: 67,301,418 R1399H possibly damaging Het
Nop2 T C 6: 125,140,643 I424T probably benign Het
Olfm5 T C 7: 104,154,462 R265G probably damaging Het
Olfr1352 C T 10: 78,984,537 S249F possibly damaging Het
Olfr1406 A G 1: 173,184,251 F61S probably damaging Het
Opalin T C 19: 41,069,953 T14A probably benign Het
Pced1b C A 15: 97,384,393 S104R probably benign Het
Pdia2 T G 17: 26,197,163 Q310P probably null Het
Ppil6 A G 10: 41,498,545 T141A probably benign Het
Prrc2b A G 2: 32,221,343 probably null Het
Stxbp5 A G 10: 9,808,508 S573P probably benign Het
Synpo2l C A 14: 20,662,292 A87S probably damaging Het
Tor1b GGACG GG 2: 30,956,945 probably benign Het
Vmn1r89 A T 7: 13,220,267 H121L probably benign Het
Vmn2r99 T A 17: 19,394,146 C709* probably null Het
Vstm4 A G 14: 32,863,878 H134R possibly damaging Het
Zan C T 5: 137,454,000 C1569Y unknown Het
Zdhhc13 A G 7: 48,805,575 T122A possibly damaging Het
Zpbp2 G T 11: 98,557,603 V249L probably benign Het
Other mutations in Ercc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Ercc3 APN 18 32264545 splice site probably benign
IGL01108:Ercc3 APN 18 32264585 missense probably damaging 0.99
IGL01131:Ercc3 APN 18 32269889 makesense probably null
IGL01541:Ercc3 APN 18 32248319 missense possibly damaging 0.87
IGL01959:Ercc3 APN 18 32257358 missense probably damaging 1.00
IGL02862:Ercc3 APN 18 32243202 critical splice donor site probably null
IGL03107:Ercc3 APN 18 32248307 missense possibly damaging 0.95
IGL03334:Ercc3 APN 18 32240837 critical splice donor site probably null
PIT4651001:Ercc3 UTSW 18 32240312 unclassified probably benign
R0545:Ercc3 UTSW 18 32245902 missense probably damaging 1.00
R0561:Ercc3 UTSW 18 32245539 missense possibly damaging 0.85
R1159:Ercc3 UTSW 18 32264558 missense possibly damaging 0.86
R1496:Ercc3 UTSW 18 32261297 splice site probably benign
R1733:Ercc3 UTSW 18 32267165 missense possibly damaging 0.60
R1943:Ercc3 UTSW 18 32246610 missense probably damaging 1.00
R2013:Ercc3 UTSW 18 32248429 missense probably benign
R2015:Ercc3 UTSW 18 32248429 missense probably benign
R2303:Ercc3 UTSW 18 32245547 missense probably benign 0.08
R4393:Ercc3 UTSW 18 32265621 missense probably benign 0.00
R4600:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4601:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4602:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4603:Ercc3 UTSW 18 32245571 missense probably benign 0.00
R4796:Ercc3 UTSW 18 32248310 missense probably damaging 1.00
R4957:Ercc3 UTSW 18 32243117 missense probably damaging 1.00
R5253:Ercc3 UTSW 18 32269864 missense probably damaging 0.97
R5265:Ercc3 UTSW 18 32254243 missense probably damaging 0.99
R5342:Ercc3 UTSW 18 32245595 missense probably benign 0.01
R5639:Ercc3 UTSW 18 32265714 missense probably damaging 0.99
R5702:Ercc3 UTSW 18 32254153 missense probably damaging 0.99
R6026:Ercc3 UTSW 18 32245921 critical splice donor site probably null
R6053:Ercc3 UTSW 18 32246754 missense probably damaging 1.00
R6650:Ercc3 UTSW 18 32261336 missense probably damaging 1.00
R7150:Ercc3 UTSW 18 32257272 missense probably damaging 1.00
R7783:Ercc3 UTSW 18 32248243 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTTACAACTCACAGAGCCCTC -3'
(R):5'- ATGCTCATAGGCGTGTCTGC -3'

Sequencing Primer
(F):5'- ACAGAGCCCTCATCTGATGTG -3'
(R):5'- TGCGTACATGTGCCCAC -3'
Posted On2016-10-06