Incidental Mutation 'R5456:Olfr1257'
ID 432743
Institutional Source Beutler Lab
Gene Symbol Olfr1257
Ensembl Gene ENSMUSG00000049057
Gene Name olfactory receptor 1257
Synonyms MOR232-1, GA_x6K02T2Q125-51319458-51320387
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R5456 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 89878437-89883026 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 89881258 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 144 (G144E)
Ref Sequence ENSEMBL: ENSMUSP00000107144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060795] [ENSMUST00000111519]
AlphaFold Q8VGP0
Predicted Effect probably damaging
Transcript: ENSMUST00000060795
AA Change: G144E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056439
Gene: ENSMUSG00000049057
AA Change: G144E

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 2.6e-31 PFAM
Pfam:7tm_4 137 278 8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111519
AA Change: G144E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000107144
Gene: ENSMUSG00000049057
AA Change: G144E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.5e-49 PFAM
Pfam:7tm_1 39 285 3.9e-18 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Olfr1257
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01600:Olfr1257 APN 2 89881662 missense probably benign 0.02
IGL01641:Olfr1257 APN 2 89881608 missense probably benign 0.01
IGL01668:Olfr1257 APN 2 89881099 missense probably benign 0.01
IGL01901:Olfr1257 APN 2 89881482 missense probably damaging 1.00
IGL02401:Olfr1257 APN 2 89881453 missense probably damaging 1.00
IGL02472:Olfr1257 APN 2 89881411 missense probably benign 0.44
IGL02631:Olfr1257 APN 2 89881255 missense possibly damaging 0.95
PIT4354001:Olfr1257 UTSW 2 89881508 missense probably benign 0.04
R0552:Olfr1257 UTSW 2 89880891 nonsense probably null
R0616:Olfr1257 UTSW 2 89881591 missense probably benign 0.07
R0943:Olfr1257 UTSW 2 89880961 missense probably benign 0.11
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1146:Olfr1257 UTSW 2 89881206 missense probably damaging 1.00
R1314:Olfr1257 UTSW 2 89880877 missense probably benign 0.35
R1641:Olfr1257 UTSW 2 89881401 missense probably benign 0.07
R1763:Olfr1257 UTSW 2 89881129 missense probably damaging 0.99
R1836:Olfr1257 UTSW 2 89881285 missense probably damaging 1.00
R2125:Olfr1257 UTSW 2 89881638 missense probably benign
R4322:Olfr1257 UTSW 2 89881734 missense probably benign 0.07
R4897:Olfr1257 UTSW 2 89881132 missense probably benign 0.39
R5446:Olfr1257 UTSW 2 89881549 missense probably damaging 1.00
R6415:Olfr1257 UTSW 2 89880862 missense probably damaging 1.00
R6905:Olfr1257 UTSW 2 89881708 missense probably benign 0.05
R7170:Olfr1257 UTSW 2 89880841 missense probably benign 0.12
R7170:Olfr1257 UTSW 2 89881053 missense possibly damaging 0.70
R7411:Olfr1257 UTSW 2 89881261 missense probably damaging 0.98
R8171:Olfr1257 UTSW 2 89881065 missense probably benign 0.05
R8490:Olfr1257 UTSW 2 89881167 missense probably damaging 1.00
R9176:Olfr1257 UTSW 2 89881171 missense probably benign 0.05
R9204:Olfr1257 UTSW 2 89881138 missense probably damaging 1.00
R9751:Olfr1257 UTSW 2 89881612 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTAGCACCCCTAAACTGATAGC -3'
(R):5'- TCTTTAGGGAGCGCAGGATG -3'

Sequencing Primer
(F):5'- TCACTCTGTGAAAAGAAGACCATC -3'
(R):5'- TAGCAGACAAATAAAACCACTGTTG -3'
Posted On 2016-10-06