Incidental Mutation 'R5456:Apmap'
ID432744
Institutional Source Beutler Lab
Gene Symbol Apmap
Ensembl Gene ENSMUSG00000033096
Gene Nameadipocyte plasma membrane associated protein
Synonyms2310001A20Rik
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location150583080-150608567 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150590069 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 128 (I128L)
Ref Sequence ENSEMBL: ENSMUSP00000040840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046399]
Predicted Effect probably benign
Transcript: ENSMUST00000046399
AA Change: I128L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000040840
Gene: ENSMUSG00000033096
AA Change: I128L

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
Pfam:SGL 101 327 1.4e-17 PFAM
Pfam:Str_synth 200 288 1.2e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145325
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Apmap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03135:Apmap APN 2 150587115 missense possibly damaging 0.89
R0898:Apmap UTSW 2 150585749 splice site probably benign
R2267:Apmap UTSW 2 150588901 critical splice donor site probably null
R4171:Apmap UTSW 2 150584067 missense probably benign 0.01
R5815:Apmap UTSW 2 150600251 missense probably benign 0.00
R5838:Apmap UTSW 2 150585857 missense probably damaging 1.00
R5846:Apmap UTSW 2 150608421 missense probably damaging 0.99
R6117:Apmap UTSW 2 150600332 missense probably benign 0.13
R6899:Apmap UTSW 2 150594308 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CACTGCCCAACTGGACACTC -3'
(R):5'- ACCTGCTGGCTTGTTTCTTTACA -3'

Sequencing Primer
(F):5'- CTCCAAGGCCAGATGACTG -3'
(R):5'- CATATCACCATCATTTTCAGAATTGC -3'
Posted On2016-10-06