Incidental Mutation 'R5456:Igsf3'
ID432746
Institutional Source Beutler Lab
Gene Symbol Igsf3
Ensembl Gene ENSMUSG00000042035
Gene Nameimmunoglobulin superfamily, member 3
Synonyms1700016K10Rik, 4833439O17Rik, 2810035F16Rik
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location101377083-101463059 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101427221 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 205 (H205Y)
Ref Sequence ENSEMBL: ENSMUSP00000048900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043983] [ENSMUST00000195164]
Predicted Effect probably benign
Transcript: ENSMUST00000043983
AA Change: H205Y

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000048900
Gene: ENSMUSG00000042035
AA Change: H205Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 7.7e-5 SMART
IG 152 275 1.99e-7 SMART
IG 287 405 1.79e0 SMART
IG 417 539 6.26e-5 SMART
IG 553 674 3.16e-1 SMART
IG 686 811 4.89e-7 SMART
IG 823 947 8.38e-6 SMART
IG 959 1109 6.97e-3 SMART
transmembrane domain 1125 1147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195164
AA Change: H205Y

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141823
Gene: ENSMUSG00000042035
AA Change: H205Y

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 142 3.1e-7 SMART
IG 152 275 8.2e-10 SMART
IG 287 405 7.4e-3 SMART
IG 437 559 2.5e-7 SMART
IG 573 694 1.3e-3 SMART
IG 706 831 1.9e-9 SMART
IG 843 967 3.4e-8 SMART
IG 979 1129 2.9e-5 SMART
transmembrane domain 1145 1167 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199431
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an immunoglobulin-like membrane protein containing several V-type Ig-like domains. A mutation in this gene has been associated with bilateral nasolacrimal duct obstruction (LCDD). [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Igsf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Igsf3 APN 3 101431239 missense probably damaging 0.99
IGL00907:Igsf3 APN 3 101427448 splice site probably benign
IGL01321:Igsf3 APN 3 101427022 splice site probably benign
IGL01340:Igsf3 APN 3 101439679 nonsense probably null
IGL02291:Igsf3 APN 3 101439529 missense probably damaging 1.00
PIT4402001:Igsf3 UTSW 3 101427077 missense probably benign 0.00
R0090:Igsf3 UTSW 3 101435652 missense probably damaging 1.00
R0143:Igsf3 UTSW 3 101435601 missense probably damaging 1.00
R0418:Igsf3 UTSW 3 101435435 missense probably damaging 0.99
R0711:Igsf3 UTSW 3 101427393 missense probably benign 0.31
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1195:Igsf3 UTSW 3 101458103 missense probably benign 0.05
R1384:Igsf3 UTSW 3 101451296 critical splice donor site probably null
R1594:Igsf3 UTSW 3 101451077 nonsense probably null
R1624:Igsf3 UTSW 3 101455227 missense probably benign 0.37
R1766:Igsf3 UTSW 3 101431282 missense probably damaging 1.00
R1988:Igsf3 UTSW 3 101431296 missense probably benign 0.03
R2072:Igsf3 UTSW 3 101439515 missense probably benign 0.02
R4707:Igsf3 UTSW 3 101458094 missense probably benign 0.06
R4976:Igsf3 UTSW 3 101439361 splice site probably null
R4982:Igsf3 UTSW 3 101435667 missense probably benign 0.42
R5008:Igsf3 UTSW 3 101450917 missense probably damaging 0.97
R5119:Igsf3 UTSW 3 101439361 splice site probably null
R5189:Igsf3 UTSW 3 101431527 missense possibly damaging 0.64
R5776:Igsf3 UTSW 3 101425480 missense probably benign 0.01
R6112:Igsf3 UTSW 3 101451006 missense probably damaging 1.00
R6383:Igsf3 UTSW 3 101435648 missense probably benign 0.05
R6758:Igsf3 UTSW 3 101425498 missense probably damaging 0.98
R7085:Igsf3 UTSW 3 101455489 missense probably benign 0.12
R7310:Igsf3 UTSW 3 101431579 missense probably benign 0.01
R7470:Igsf3 UTSW 3 101451075 missense possibly damaging 0.67
R7707:Igsf3 UTSW 3 101459922 missense probably benign 0.00
R7719:Igsf3 UTSW 3 101435541 missense probably damaging 1.00
R7739:Igsf3 UTSW 3 101435531 missense probably damaging 1.00
X0027:Igsf3 UTSW 3 101435645 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGATTCTCTGCAGACCACG -3'
(R):5'- GTCATCAAACAAGGCGTCCC -3'

Sequencing Primer
(F):5'- TCTGCAGACCACGGCTGTC -3'
(R):5'- GCTTCCTGGTCATGGCGTAC -3'
Posted On2016-10-06