Incidental Mutation 'R5456:Hemgn'
ID432748
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Namehemogen
Synonyms4921524M03Rik, EDAG
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location46393989-46413506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46396571 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 222 (V222M)
Ref Sequence ENSEMBL: ENSMUSP00000103393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
Predicted Effect probably damaging
Transcript: ENSMUST00000071096
AA Change: V222M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: V222M

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107764
AA Change: V222M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: V222M

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46396240 missense probably benign
IGL00846:Hemgn APN 4 46396171 missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46396383 nonsense probably null
IGL01875:Hemgn APN 4 46396994 missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46396057 missense probably damaging 1.00
IGL02217:Hemgn APN 4 46396420 missense probably damaging 0.98
IGL02325:Hemgn APN 4 46396085 missense probably benign 0.05
IGL02746:Hemgn APN 4 46400740 missense probably damaging 0.99
IGL03093:Hemgn APN 4 46396504 missense probably benign 0.26
IGL03240:Hemgn APN 4 46400732 nonsense probably null
PIT4504001:Hemgn UTSW 4 46395863 missense probably benign
R0925:Hemgn UTSW 4 46397049 missense probably damaging 0.98
R1413:Hemgn UTSW 4 46396091 missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46395958 missense probably damaging 0.97
R1844:Hemgn UTSW 4 46396655 missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46396607 nonsense probably null
R2169:Hemgn UTSW 4 46396417 missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46396301 missense possibly damaging 0.66
R3742:Hemgn UTSW 4 46396421 missense possibly damaging 0.94
R4515:Hemgn UTSW 4 46396477 missense probably damaging 0.98
R5310:Hemgn UTSW 4 46403927 missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46400738 missense probably benign 0.09
R6520:Hemgn UTSW 4 46396466 missense probably damaging 0.98
R6575:Hemgn UTSW 4 46395990 missense possibly damaging 0.46
R6983:Hemgn UTSW 4 46395997 missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46397054 missense possibly damaging 0.94
R7443:Hemgn UTSW 4 46396145 missense probably damaging 0.96
R7567:Hemgn UTSW 4 46397034 missense probably damaging 0.96
R7623:Hemgn UTSW 4 46396504 missense probably benign 0.07
Z1177:Hemgn UTSW 4 46400693 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAGCATCTCCAGGTGTTACAC -3'
(R):5'- TCTCCTACCACATGCCAAGG -3'

Sequencing Primer
(F):5'- TCTCCAGGTGTTACACAGGGAAAG -3'
(R):5'- TGCCAAGGAATAGCAGTACTTC -3'
Posted On2016-10-06