Incidental Mutation 'R5456:Cd22'
ID 432753
Institutional Source Beutler Lab
Gene Symbol Cd22
Ensembl Gene ENSMUSG00000030577
Gene Name CD22 antigen
Synonyms Lyb-8, Lyb8
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5456 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 30865402-30880342 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 30876039 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 193 (I193V)
Ref Sequence ENSEMBL: ENSMUSP00000139871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000108125] [ENSMUST00000186154] [ENSMUST00000187989] [ENSMUST00000188157] [ENSMUST00000189718] [ENSMUST00000190617] [ENSMUST00000190646] [ENSMUST00000214289] [ENSMUST00000190753]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019248
AA Change: I193V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577
AA Change: I193V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108125
AA Change: I193V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000103760
Gene: ENSMUSG00000030577
AA Change: I193V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186154
AA Change: I193V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139685
Gene: ENSMUSG00000030577
AA Change: I193V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187585
Predicted Effect probably benign
Transcript: ENSMUST00000187989
Predicted Effect probably benign
Transcript: ENSMUST00000188157
SMART Domains Protein: ENSMUSP00000140450
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189718
AA Change: I193V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140521
Gene: ENSMUSG00000030577
AA Change: I193V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190170
Predicted Effect probably benign
Transcript: ENSMUST00000190617
AA Change: I193V

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000139871
Gene: ENSMUSG00000030577
AA Change: I193V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190646
AA Change: I193V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140528
Gene: ENSMUSG00000030577
AA Change: I193V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 1.1e-3 SMART
IG_like 166 245 1.6e-2 SMART
IGc2 269 337 1.1e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000214289
AA Change: I193V
Predicted Effect probably benign
Transcript: ENSMUST00000190753
Predicted Effect probably benign
Transcript: ENSMUST00000190455
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have reduced mature B cell numbers with altered proliferation kinetics and reduced antibody production to T cell independent antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Cd22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Cd22 APN 7 30876147 missense probably benign 0.01
IGL02236:Cd22 APN 7 30867468 missense possibly damaging 0.54
IGL02321:Cd22 APN 7 30869883 missense probably damaging 1.00
IGL02335:Cd22 APN 7 30876134 missense probably damaging 1.00
IGL02397:Cd22 APN 7 30877625 missense probably benign
IGL02402:Cd22 APN 7 30877530 missense possibly damaging 0.86
IGL02538:Cd22 APN 7 30877560 missense probably benign 0.40
IGL02736:Cd22 APN 7 30878045 splice site probably null
blitz UTSW 7 30869904 missense probably damaging 1.00
crullers UTSW 7 30869883 missense probably damaging 1.00
gansu UTSW 7 30870105 missense probably damaging 1.00
lacrima UTSW 7 30876153 missense probably damaging 1.00
Lluvia UTSW 7 30870487 missense possibly damaging 0.48
Mist UTSW 7 30866658 missense probably damaging 1.00
rain UTSW 7 30877534 missense probably damaging 1.00
well UTSW 7 30877787 nonsense probably null
Yosemite UTSW 7 30869509 critical splice donor site probably null
FR4304:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4340:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4342:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
FR4589:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
LCD18:Cd22 UTSW 7 30878082 missense possibly damaging 0.95
PIT4142001:Cd22 UTSW 7 30877799 missense possibly damaging 0.92
R0123:Cd22 UTSW 7 30867108 splice site probably benign
R0130:Cd22 UTSW 7 30869964 missense possibly damaging 0.92
R0926:Cd22 UTSW 7 30869509 critical splice donor site probably null
R1245:Cd22 UTSW 7 30869883 missense probably damaging 1.00
R1332:Cd22 UTSW 7 30870487 missense possibly damaging 0.48
R1457:Cd22 UTSW 7 30873170 missense probably benign 0.07
R1716:Cd22 UTSW 7 30877678 missense probably damaging 1.00
R1980:Cd22 UTSW 7 30873233 missense probably damaging 1.00
R2017:Cd22 UTSW 7 30872780 missense probably damaging 0.99
R2061:Cd22 UTSW 7 30870105 missense probably damaging 1.00
R2061:Cd22 UTSW 7 30876156 missense probably benign 0.03
R2075:Cd22 UTSW 7 30869698 missense probably damaging 1.00
R2216:Cd22 UTSW 7 30867046 missense probably damaging 1.00
R3886:Cd22 UTSW 7 30870107 missense possibly damaging 0.57
R4599:Cd22 UTSW 7 30875900 missense probably damaging 0.98
R4701:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R4796:Cd22 UTSW 7 30872956 splice site probably null
R5179:Cd22 UTSW 7 30875874 missense possibly damaging 0.81
R5233:Cd22 UTSW 7 30877534 missense probably damaging 1.00
R5511:Cd22 UTSW 7 30870071 missense probably damaging 1.00
R5513:Cd22 UTSW 7 30867025 missense probably damaging 0.99
R5611:Cd22 UTSW 7 30878150 unclassified probably benign
R5656:Cd22 UTSW 7 30869773 missense probably damaging 1.00
R5966:Cd22 UTSW 7 30866658 missense probably damaging 1.00
R6329:Cd22 UTSW 7 30877768 missense probably damaging 0.99
R6356:Cd22 UTSW 7 30877702 missense probably damaging 1.00
R6455:Cd22 UTSW 7 30876153 missense probably damaging 1.00
R6550:Cd22 UTSW 7 30877552 missense probably benign 0.00
R6656:Cd22 UTSW 7 30877757 missense probably benign 0.11
R6688:Cd22 UTSW 7 30872964 missense possibly damaging 0.91
R6844:Cd22 UTSW 7 30873431 splice site probably null
R6957:Cd22 UTSW 7 30867574 missense possibly damaging 0.88
R7068:Cd22 UTSW 7 30878079 missense probably benign 0.03
R7083:Cd22 UTSW 7 30868048 missense probably damaging 0.99
R7225:Cd22 UTSW 7 30877634 missense not run
R7732:Cd22 UTSW 7 30870057 missense probably damaging 1.00
R8686:Cd22 UTSW 7 30870069 missense probably benign 0.03
R8851:Cd22 UTSW 7 30877659 missense probably benign 0.01
R8987:Cd22 UTSW 7 30877747 missense probably damaging 1.00
R9051:Cd22 UTSW 7 30876024 missense probably benign
R9098:Cd22 UTSW 7 30867966 missense probably benign 0.00
R9124:Cd22 UTSW 7 30873237 missense probably benign 0.01
R9167:Cd22 UTSW 7 30876005 missense probably benign 0.07
R9319:Cd22 UTSW 7 30869904 missense probably damaging 1.00
R9369:Cd22 UTSW 7 30877574 missense probably benign 0.09
X0025:Cd22 UTSW 7 30873419 splice site probably null
Z1176:Cd22 UTSW 7 30867963 missense probably benign 0.03
Z1176:Cd22 UTSW 7 30869530 missense probably damaging 1.00
Z1186:Cd22 UTSW 7 30867053 missense probably benign 0.01
Z1186:Cd22 UTSW 7 30867466 missense probably benign
Z1186:Cd22 UTSW 7 30875867 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGGTGACAGGTAGCATCCTTC -3'
(R):5'- TGTGTCCCATCTCCAGCAAG -3'

Sequencing Primer
(F):5'- TTAACATCCAGACGCACAGTG -3'
(R):5'- AGCAAGCAGGCCTCTCTC -3'
Posted On 2016-10-06