Incidental Mutation 'R5456:Nat2'
ID432756
Institutional Source Beutler Lab
Gene Symbol Nat2
Ensembl Gene ENSMUSG00000051147
Gene NameN-acetyltransferase 2 (arylamine N-acetyltransferase)
Synonyms
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.695) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location67494858-67502584 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67501573 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 112 (V112I)
Ref Sequence ENSEMBL: ENSMUSP00000130065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093470] [ENSMUST00000163856]
Predicted Effect probably damaging
Transcript: ENSMUST00000093470
AA Change: V112I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091181
Gene: ENSMUSG00000051147
AA Change: V112I

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.6e-99 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163856
AA Change: V112I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130065
Gene: ENSMUSG00000051147
AA Change: V112I

DomainStartEndE-ValueType
Pfam:Acetyltransf_2 20 280 3.3e-98 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two arylamine N-acetyltransferase (NAT) genes in the human genome, and is orthologous to the mouse and rat Nat2 genes. The enzyme encoded by this gene catalyzes the transfer of an acetyl group from acetyl-CoA to various arylamine and hydrazine substrates. This enzyme helps metabolize drugs and other xenobiotics, and functions in folate catabolism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Inactivation of this gene does not result in an overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Nat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Nat2 APN 8 67501541 missense probably damaging 1.00
IGL02341:Nat2 APN 8 67501718 missense possibly damaging 0.46
IGL03010:Nat2 APN 8 67502012 missense probably damaging 1.00
R0112:Nat2 UTSW 8 67501726 nonsense probably null
R0511:Nat2 UTSW 8 67501330 nonsense probably null
R0600:Nat2 UTSW 8 67501267 missense probably damaging 1.00
R0690:Nat2 UTSW 8 67501804 missense probably damaging 1.00
R1865:Nat2 UTSW 8 67501552 missense possibly damaging 0.61
R4118:Nat2 UTSW 8 67501619 missense possibly damaging 0.94
R7859:Nat2 UTSW 8 67501350 missense probably damaging 1.00
R7942:Nat2 UTSW 8 67501350 missense probably damaging 1.00
Z1176:Nat2 UTSW 8 67501264 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AACATCCATTGTGGGGAATCC -3'
(R):5'- CTTGGTTTGGAACATACTGCTCTC -3'

Sequencing Primer
(F):5'- CCATGGAACTGAGTTTAGAAGCCATC -3'
(R):5'- CTTCTGATTTGGTCCAAGTACCAGG -3'
Posted On2016-10-06