Incidental Mutation 'R5456:Wdr83'
ID432757
Institutional Source Beutler Lab
Gene Symbol Wdr83
Ensembl Gene ENSMUSG00000005150
Gene NameWD repeat domain containing 83
Synonyms1500041N16Rik, Morg1
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85075035-85081306 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85080208 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 81 (H81R)
Ref Sequence ENSEMBL: ENSMUSP00000122127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034121] [ENSMUST00000079764] [ENSMUST00000093357] [ENSMUST00000140621] [ENSMUST00000149050] [ENSMUST00000152785] [ENSMUST00000209264] [ENSMUST00000209361]
Predicted Effect probably benign
Transcript: ENSMUST00000034121
SMART Domains Protein: ENSMUSP00000034121
Gene: ENSMUSG00000005142

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
Pfam:Glyco_hydro_38 64 381 2.7e-96 PFAM
Alpha-mann_mid 386 465 4.25e-23 SMART
Pfam:Glyco_hydro_38C 510 1002 6.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079764
SMART Domains Protein: ENSMUSP00000078697
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
Pfam:UPF0139 85 183 6.8e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093357
AA Change: H81R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000091048
Gene: ENSMUSG00000005150
AA Change: H81R

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 98 137 8.1e-9 SMART
WD40 142 179 5.52e-2 SMART
WD40 182 219 1.66e0 SMART
WD40 222 263 7e-4 SMART
WD40 266 304 4.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135463
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136696
Predicted Effect probably benign
Transcript: ENSMUST00000140621
SMART Domains Protein: ENSMUSP00000117962
Gene: ENSMUSG00000059355

DomainStartEndE-ValueType
Pfam:UPF0139 5 88 1.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142201
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145880
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148592
Predicted Effect probably benign
Transcript: ENSMUST00000149050
AA Change: H81R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121568
Gene: ENSMUSG00000005150
AA Change: H81R

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152186
Predicted Effect probably benign
Transcript: ENSMUST00000152785
AA Change: H81R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122127
Gene: ENSMUSG00000005150
AA Change: H81R

DomainStartEndE-ValueType
WD40 14 53 1.05e-7 SMART
WD40 56 95 8.42e-7 SMART
WD40 140 177 5.52e-2 SMART
WD40 180 217 1.66e0 SMART
WD40 220 261 7e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209264
Predicted Effect probably benign
Transcript: ENSMUST00000209361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211379
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-40 protein family. The protein is proposed to function as a molecular scaffold for various multimeric protein complexes. The protein associates with several components of the extracellular signal-regulated kinase (ERK) pathway, and promotes ERK activity in response to serum or other signals. The protein also interacts with egl nine homolog 3 (EGLN3, also known as PHD3) and regulates expression of hypoxia-inducible factor 1, and has been purified as part of the spliceosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality at E10.5 due to diffuse vascularization and placental insufficiency. Mice heterozygous for the same reporter allele exhibit decreased susceptibility to kidney reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Other mutations in Wdr83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Wdr83 APN 8 85079814 missense probably damaging 1.00
IGL01671:Wdr83 APN 8 85075819 unclassified probably benign
IGL02081:Wdr83 APN 8 85075843 missense probably benign 0.08
IGL03293:Wdr83 APN 8 85080587 missense probably benign 0.09
R0062:Wdr83 UTSW 8 85079827 missense possibly damaging 0.67
R0062:Wdr83 UTSW 8 85079827 missense possibly damaging 0.67
R3729:Wdr83 UTSW 8 85080339 missense probably damaging 1.00
R4664:Wdr83 UTSW 8 85080051 unclassified probably benign
R4758:Wdr83 UTSW 8 85075238 missense probably benign 0.25
R6687:Wdr83 UTSW 8 85080149 missense probably benign 0.00
R7078:Wdr83 UTSW 8 85076051 missense probably damaging 1.00
R7172:Wdr83 UTSW 8 85079824 missense probably damaging 0.98
R7311:Wdr83 UTSW 8 85076261 missense probably benign 0.21
R7349:Wdr83 UTSW 8 85079831 missense possibly damaging 0.59
R7449:Wdr83 UTSW 8 85079681 missense probably damaging 1.00
R7570:Wdr83 UTSW 8 85079834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGGTATACTAGATGGGCACAATG -3'
(R):5'- ACCCTAAAGCTGTGGAACCC -3'

Sequencing Primer
(F):5'- AGACTGTGATGGAAGGATCTTC -3'
(R):5'- GTGGAACCCGCTGCGTG -3'
Posted On2016-10-06