Incidental Mutation 'R5456:Bend3'
ID432761
Institutional Source Beutler Lab
Gene Symbol Bend3
Ensembl Gene ENSMUSG00000038214
Gene NameBEN domain containing 3
Synonyms
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location43478831-43515396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43510546 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 312 (Y312H)
Ref Sequence ENSEMBL: ENSMUSP00000127351 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040147] [ENSMUST00000167488] [ENSMUST00000214116] [ENSMUST00000216679]
Predicted Effect probably damaging
Transcript: ENSMUST00000040147
AA Change: Y312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047251
Gene: ENSMUSG00000038214
AA Change: Y312H

DomainStartEndE-ValueType
low complexity region 159 172 N/A INTRINSIC
BEN 261 340 1.76e-15 SMART
BEN 405 484 5.75e-20 SMART
BEN 568 647 4.71e-16 SMART
low complexity region 674 690 N/A INTRINSIC
low complexity region 704 715 N/A INTRINSIC
BEN 734 813 1.02e-20 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167488
AA Change: Y312H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127351
Gene: ENSMUSG00000038214
AA Change: Y312H

DomainStartEndE-ValueType
low complexity region 159 172 N/A INTRINSIC
BEN 261 340 1.76e-15 SMART
BEN 405 484 5.75e-20 SMART
BEN 568 647 4.71e-16 SMART
low complexity region 674 690 N/A INTRINSIC
low complexity region 704 715 N/A INTRINSIC
BEN 734 813 1.02e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214116
Predicted Effect probably benign
Transcript: ENSMUST00000216679
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Bend3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Bend3 APN 10 43511543 missense probably damaging 1.00
IGL00977:Bend3 APN 10 43510949 missense possibly damaging 0.95
IGL00980:Bend3 APN 10 43511566 missense probably damaging 1.00
IGL02457:Bend3 APN 10 43509950 missense probably damaging 0.99
PIT4515001:Bend3 UTSW 10 43510634 missense probably damaging 0.98
R0148:Bend3 UTSW 10 43511950 missense probably damaging 1.00
R1484:Bend3 UTSW 10 43510201 missense probably benign
R2046:Bend3 UTSW 10 43511846 missense probably damaging 1.00
R2098:Bend3 UTSW 10 43510504 missense probably damaging 1.00
R3419:Bend3 UTSW 10 43509982 missense probably damaging 1.00
R3854:Bend3 UTSW 10 43510717 unclassified probably benign
R4449:Bend3 UTSW 10 43512083 missense possibly damaging 0.90
R4765:Bend3 UTSW 10 43510750 missense probably damaging 1.00
R5070:Bend3 UTSW 10 43493685 missense probably damaging 0.99
R5299:Bend3 UTSW 10 43493690 critical splice donor site probably null
R5530:Bend3 UTSW 10 43511726 missense probably damaging 1.00
R5976:Bend3 UTSW 10 43510544 missense probably benign 0.00
R6173:Bend3 UTSW 10 43509868 missense probably benign 0.00
R7227:Bend3 UTSW 10 43511405 missense probably damaging 1.00
R7256:Bend3 UTSW 10 43493671 missense probably benign 0.12
RF010:Bend3 UTSW 10 43510184 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TGTCAAGAAGCAGGTGAGCC -3'
(R):5'- GTCCTTGTTGTCCAGAAAGTG -3'

Sequencing Primer
(F):5'- AAGAAGCAGGTGAGCCCTTCC -3'
(R):5'- AGAAAGTGGCCGGCATCC -3'
Posted On2016-10-06