Incidental Mutation 'R5456:Dcbld1'
ID432762
Institutional Source Beutler Lab
Gene Symbol Dcbld1
Ensembl Gene ENSMUSG00000019891
Gene Namediscoidin, CUB and LCCL domain containing 1
Synonyms4631413K11Rik
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location52233619-52321378 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52314390 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 215 (D215G)
Ref Sequence ENSEMBL: ENSMUSP00000151265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069004] [ENSMUST00000218582]
Predicted Effect probably benign
Transcript: ENSMUST00000069004
AA Change: D286G

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000068203
Gene: ENSMUSG00000019891
AA Change: D286G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CUB 32 141 6.42e-23 SMART
Pfam:LCCL 147 239 4.5e-19 PFAM
transmembrane domain 248 270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105476
AA Change: D215G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101116
Gene: ENSMUSG00000019891
AA Change: D215G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCOP:d1sfp__ 28 69 3e-6 SMART
Pfam:LCCL 76 168 3.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218582
AA Change: D215G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Dcbld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dcbld1 APN 10 52312849 missense probably benign
IGL01974:Dcbld1 APN 10 52304681 missense probably benign 0.00
IGL01997:Dcbld1 APN 10 52317110 missense probably damaging 0.98
IGL02811:Dcbld1 APN 10 52319973 missense probably benign
IGL03011:Dcbld1 APN 10 52284148 missense probably damaging 0.98
IGL03329:Dcbld1 APN 10 52319625 missense probably damaging 0.99
IGL03048:Dcbld1 UTSW 10 52304626 missense probably damaging 1.00
R0392:Dcbld1 UTSW 10 52317134 missense possibly damaging 0.92
R0532:Dcbld1 UTSW 10 52317077 missense probably benign 0.06
R0561:Dcbld1 UTSW 10 52261936 missense probably benign 0.02
R0625:Dcbld1 UTSW 10 52312850 missense probably benign 0.38
R0907:Dcbld1 UTSW 10 52261814 missense possibly damaging 0.83
R1567:Dcbld1 UTSW 10 52319656 missense probably damaging 1.00
R1791:Dcbld1 UTSW 10 52319476 missense probably damaging 0.99
R1915:Dcbld1 UTSW 10 52317035 missense probably damaging 0.98
R1921:Dcbld1 UTSW 10 52319651 missense possibly damaging 0.94
R2119:Dcbld1 UTSW 10 52319979 missense probably benign
R2163:Dcbld1 UTSW 10 52286356 missense probably damaging 1.00
R2520:Dcbld1 UTSW 10 52319545 missense probably damaging 0.99
R3196:Dcbld1 UTSW 10 52319491 missense probably damaging 0.99
R3788:Dcbld1 UTSW 10 52319658 missense probably damaging 1.00
R4797:Dcbld1 UTSW 10 52284127 missense probably damaging 0.99
R4904:Dcbld1 UTSW 10 52319970 nonsense probably null
R5177:Dcbld1 UTSW 10 52304634 missense probably damaging 1.00
R5329:Dcbld1 UTSW 10 52284257 intron probably benign
R6151:Dcbld1 UTSW 10 52304660 missense probably damaging 1.00
R6267:Dcbld1 UTSW 10 52319480 nonsense probably null
R6421:Dcbld1 UTSW 10 52286354 missense probably damaging 1.00
R7031:Dcbld1 UTSW 10 52290889 missense probably damaging 1.00
R7738:Dcbld1 UTSW 10 52312826 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CATATGACAGTGTCTAGCAAATTCC -3'
(R):5'- GCACCCGTCCTACAAAATTG -3'

Sequencing Primer
(F):5'- GTCTAGCAAATTCCGCTTTCAGAAC -3'
(R):5'- TTGACAGACCTCAGATGTACTGGC -3'
Posted On2016-10-06