Mutagenetix > Incidental Mutation

Incidental Mutation 'R5456:Acot12'

432765

Institutional Source

Beutler Lab

Gene Symbol

Acot12

Ensembl Gene

ENSMUSG00000021620

Gene Name

acyl-CoA thioesterase 12

Synonyms

Cach, 1300004O04Rik, 4930449F15Rik

MMRRC Submission

043019-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.054) question?

Stock #

R5456 (G1)

Quality Score

150

Status

Not validated

Chromosome

Chromosomal Location

91741512-91786148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 91741640 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 37 (D37G)

Ref Sequence

ENSEMBL: ENSMUSP00000022120 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022120]

AlphaFold

Q9DBK0

Predicted Effect

probably damaging
Transcript: ENSMUST00000022120
AA Change: D37G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620
AA Change: D37G

Domain	Start	End	E-Value	Type
Pfam:4HBT	25	97	4.2e-12	PFAM
Pfam:4HBT	198	275	2.5e-14	PFAM
low complexity region	317	328	N/A	INTRINSIC
Pfam:START	350	515	1.5e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000099331

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160385

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161337

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161491

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy5	T	C	16: 35,298,522	F1081S	probably damaging	Het
Apmap	T	A	2: 150,590,069	I128L	probably benign	Het
Arhgap12	G	A	18: 6,112,170	Q65*	probably null	Het
Baat	C	T	4: 49,502,949	V58I	possibly damaging	Het
Bco2	T	C	9: 50,545,344		probably null	Het
Bend3	T	C	10: 43,510,546	Y312H	probably damaging	Het
Btnl2	A	T	17: 34,363,321	Y287F	probably benign	Het
Cd22	T	C	7: 30,876,039	I193V	probably benign	Het
Commd3	A	G	2: 18,674,157	E95G	probably damaging	Het
Dcbld1	A	G	10: 52,314,390	D215G	probably damaging	Het
Elfn1	A	G	5: 139,972,816	Y525C	probably damaging	Het
Fam83b	T	C	9: 76,492,595	T409A	probably benign	Het
Fshr	T	A	17: 88,986,348	I301F	probably benign	Het
Hemgn	C	T	4: 46,396,571	V222M	probably damaging	Het
Igsf3	C	T	3: 101,427,221	H205Y	probably benign	Het
Mfsd1	T	C	3: 67,589,833	I147T	probably benign	Het
Mslnl	A	G	17: 25,743,159	D177G	probably damaging	Het
Nat2	G	A	8: 67,501,573	V112I	probably damaging	Het
Olfr1257	G	A	2: 89,881,258	G144E	probably damaging	Het
Olfr284	G	A	15: 98,340,365	A208V	probably benign	Het
Pabpc1l	T	C	2: 164,027,660	S127P	probably damaging	Het
Poln	A	T	5: 34,007,442	L845Q	possibly damaging	Het
Ppm1f	T	A	16: 16,923,746	D361E	probably damaging	Het
Rapgef5	T	A	12: 117,728,646		probably null	Het
Rarb	G	A	14: 16,436,843	T226I	probably damaging	Het
Sel1l3	T	C	5: 53,200,036	K205E	probably benign	Het
Sh3glb1	T	A	3: 144,709,353	I75L	probably benign	Het
Srgap1	G	A	10: 121,869,811	S236L	probably benign	Het
Tmco3	A	G	8: 13,319,815	Y609C	probably damaging	Het
Trhde	A	G	10: 114,486,760	V712A	possibly damaging	Het
Trim13	A	G	14: 61,605,074	D180G	possibly damaging	Het
Tst	T	C	15: 78,399,958	E223G	probably damaging	Het
Umodl1	A	G	17: 30,982,289	I397M	probably benign	Het
Usp31	T	C	7: 121,670,277	D481G	probably damaging	Het
Vps13c	T	A	9: 67,927,447	M1686K	possibly damaging	Het
Wdr83	T	C	8: 85,080,208	H81R	probably benign	Het

Other mutations in Acot12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Acot12	APN	13	91781211	nonsense	probably null
IGL01114:Acot12	APN	13	91757592	splice site	probably benign
IGL01376:Acot12	APN	13	91784671	missense	probably damaging	0.98
IGL01474:Acot12	APN	13	91772783	missense	possibly damaging	0.53
IGL02206:Acot12	APN	13	91759987	missense	probably damaging	1.00
IGL02999:Acot12	APN	13	91759981	missense	probably damaging	0.97
IGL03237:Acot12	APN	13	91781269	missense	probably benign	0.26
R0071:Acot12	UTSW	13	91781174	splice site	probably benign
R0092:Acot12	UTSW	13	91741565	missense	probably damaging	1.00
R0141:Acot12	UTSW	13	91771828	missense	probably benign	0.02
R0331:Acot12	UTSW	13	91760064	critical splice donor site	probably null
R0525:Acot12	UTSW	13	91760067	splice site	probably benign
R0544:Acot12	UTSW	13	91784656	missense	probably benign	0.02
R1509:Acot12	UTSW	13	91771875	critical splice donor site	probably null
R1616:Acot12	UTSW	13	91772767	missense	probably benign	0.02
R1773:Acot12	UTSW	13	91757557	missense	probably benign	0.27
R1897:Acot12	UTSW	13	91784397	missense	probably benign
R2047:Acot12	UTSW	13	91783003	missense	probably damaging	1.00
R2102:Acot12	UTSW	13	91759977	missense	probably benign	0.00
R3730:Acot12	UTSW	13	91760026	missense	possibly damaging	0.61
R3735:Acot12	UTSW	13	91784346	missense	probably benign
R3736:Acot12	UTSW	13	91784346	missense	probably benign
R3912:Acot12	UTSW	13	91770089	missense	probably benign	0.01
R4156:Acot12	UTSW	13	91784763	missense	probably benign	0.00
R4418:Acot12	UTSW	13	91784405	missense	possibly damaging	0.46
R4879:Acot12	UTSW	13	91762964	missense	probably benign	0.17
R5498:Acot12	UTSW	13	91781233	missense	probably damaging	1.00
R5601:Acot12	UTSW	13	91782910	missense	probably benign	0.10
R5998:Acot12	UTSW	13	91757534	missense	possibly damaging	0.49
R6781:Acot12	UTSW	13	91784412	splice site	probably null
R7208:Acot12	UTSW	13	91781242	missense	probably benign	0.06
R7330:Acot12	UTSW	13	91741532	start codon destroyed	probably null	0.89
R7560:Acot12	UTSW	13	91784391	missense	probably benign
R7561:Acot12	UTSW	13	91770124	missense	probably damaging	0.96
R7869:Acot12	UTSW	13	91771725	missense	probably benign	0.12
R9377:Acot12	UTSW	13	91770102	missense	probably benign	0.00
R9411:Acot12	UTSW	13	91771800	missense	probably damaging	1.00
R9542:Acot12	UTSW	13	91782991	missense	probably damaging	1.00
X0050:Acot12	UTSW	13	91771837	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CCCATGCGTTTTGGAGCTAG -3'
(R):5'- CTGGGAACACTGCCCTTTAC -3'

Sequencing Primer
(F):5'- AGAGAGGCTGGCGTACTCTACTC -3'
(R):5'- GGGAACACTGCCCTTTACTTTGC -3'

Posted On

2016-10-06