Incidental Mutation 'R5456:Acot12'
ID432765
Institutional Source Beutler Lab
Gene Symbol Acot12
Ensembl Gene ENSMUSG00000021620
Gene Nameacyl-CoA thioesterase 12
SynonymsCach, 1300004O04Rik, 4930449F15Rik
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5456 (G1)
Quality Score150
Status Not validated
Chromosome13
Chromosomal Location91741512-91786148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91741640 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 37 (D37G)
Ref Sequence ENSEMBL: ENSMUSP00000022120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022120]
Predicted Effect probably damaging
Transcript: ENSMUST00000022120
AA Change: D37G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022120
Gene: ENSMUSG00000021620
AA Change: D37G

DomainStartEndE-ValueType
Pfam:4HBT 25 97 4.2e-12 PFAM
Pfam:4HBT 198 275 2.5e-14 PFAM
low complexity region 317 328 N/A INTRINSIC
Pfam:START 350 515 1.5e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000099331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161491
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Acot12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Acot12 APN 13 91781211 nonsense probably null
IGL01114:Acot12 APN 13 91757592 splice site probably benign
IGL01376:Acot12 APN 13 91784671 missense probably damaging 0.98
IGL01474:Acot12 APN 13 91772783 missense possibly damaging 0.53
IGL02206:Acot12 APN 13 91759987 missense probably damaging 1.00
IGL02999:Acot12 APN 13 91759981 missense probably damaging 0.97
IGL03237:Acot12 APN 13 91781269 missense probably benign 0.26
R0071:Acot12 UTSW 13 91781174 splice site probably benign
R0092:Acot12 UTSW 13 91741565 missense probably damaging 1.00
R0141:Acot12 UTSW 13 91771828 missense probably benign 0.02
R0331:Acot12 UTSW 13 91760064 critical splice donor site probably null
R0525:Acot12 UTSW 13 91760067 splice site probably benign
R0544:Acot12 UTSW 13 91784656 missense probably benign 0.02
R1509:Acot12 UTSW 13 91771875 critical splice donor site probably null
R1616:Acot12 UTSW 13 91772767 missense probably benign 0.02
R1773:Acot12 UTSW 13 91757557 missense probably benign 0.27
R1897:Acot12 UTSW 13 91784397 missense probably benign
R2047:Acot12 UTSW 13 91783003 missense probably damaging 1.00
R2102:Acot12 UTSW 13 91759977 missense probably benign 0.00
R3730:Acot12 UTSW 13 91760026 missense possibly damaging 0.61
R3735:Acot12 UTSW 13 91784346 missense probably benign
R3736:Acot12 UTSW 13 91784346 missense probably benign
R3912:Acot12 UTSW 13 91770089 missense probably benign 0.01
R4156:Acot12 UTSW 13 91784763 missense probably benign 0.00
R4418:Acot12 UTSW 13 91784405 missense possibly damaging 0.46
R4879:Acot12 UTSW 13 91762964 missense probably benign 0.17
R5498:Acot12 UTSW 13 91781233 missense probably damaging 1.00
R5601:Acot12 UTSW 13 91782910 missense probably benign 0.10
R5998:Acot12 UTSW 13 91757534 missense possibly damaging 0.49
R6781:Acot12 UTSW 13 91784412 splice site probably null
R7208:Acot12 UTSW 13 91781242 missense probably benign 0.06
R7330:Acot12 UTSW 13 91741532 start codon destroyed probably null 0.89
R7560:Acot12 UTSW 13 91784391 missense probably benign
R7561:Acot12 UTSW 13 91770124 missense probably damaging 0.96
R7869:Acot12 UTSW 13 91771725 missense probably benign 0.12
R7952:Acot12 UTSW 13 91771725 missense probably benign 0.12
X0050:Acot12 UTSW 13 91771837 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCCATGCGTTTTGGAGCTAG -3'
(R):5'- CTGGGAACACTGCCCTTTAC -3'

Sequencing Primer
(F):5'- AGAGAGGCTGGCGTACTCTACTC -3'
(R):5'- GGGAACACTGCCCTTTACTTTGC -3'
Posted On2016-10-06