Incidental Mutation 'R5456:Rarb'
ID432766
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Nameretinoic acid receptor, beta
SynonymsRAR beta 2, Hap, RARbeta2
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16430839-16819156 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 16436843 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 226 (T226I)
Ref Sequence ENSEMBL: ENSMUSP00000152980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017629] [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000225921]
Predicted Effect probably benign
Transcript: ENSMUST00000017629
SMART Domains Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485

DomainStartEndE-ValueType
Blast:TOP2c 32 70 7e-10 BLAST
HATPase_c 85 234 1.91e-2 SMART
TOP2c 89 679 N/A SMART
TOP4c 702 1175 2.55e-230 SMART
low complexity region 1201 1215 N/A INTRINSIC
low complexity region 1287 1299 N/A INTRINSIC
low complexity region 1324 1336 N/A INTRINSIC
low complexity region 1360 1382 N/A INTRINSIC
Pfam:DTHCT 1495 1597 4.6e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063750
AA Change: T226I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: T226I

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect probably damaging
Transcript: ENSMUST00000225921
AA Change: T226I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16443791 nonsense probably null
IGL01483:Rarb APN 14 16432273 splice site probably benign
IGL01591:Rarb APN 14 16434207 missense possibly damaging 0.93
IGL01769:Rarb APN 14 16443760 missense probably damaging 0.97
IGL01782:Rarb APN 14 16434180 missense probably damaging 1.00
IGL01866:Rarb APN 14 16443751 missense probably benign 0.17
IGL03299:Rarb APN 14 16434168 missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16436910 missense probably damaging 0.99
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0055:Rarb UTSW 14 16509066 missense probably damaging 1.00
R0849:Rarb UTSW 14 16434293 missense probably damaging 1.00
R1067:Rarb UTSW 14 16436769 missense probably damaging 0.98
R1314:Rarb UTSW 14 16508932 critical splice donor site probably null
R1416:Rarb UTSW 14 16435177 missense possibly damaging 0.82
R2894:Rarb UTSW 14 16435146 missense probably damaging 1.00
R4637:Rarb UTSW 14 16574875 missense possibly damaging 0.51
R4950:Rarb UTSW 14 16432085 unclassified probably benign
R5420:Rarb UTSW 14 16434249 missense possibly damaging 0.89
R5635:Rarb UTSW 14 16443788 missense probably damaging 1.00
R5689:Rarb UTSW 14 16434177 missense probably damaging 1.00
R5708:Rarb UTSW 14 16548545 missense probably damaging 0.99
R5819:Rarb UTSW 14 16443820 missense possibly damaging 0.68
R5935:Rarb UTSW 14 16434264 missense probably damaging 1.00
R6264:Rarb UTSW 14 16818819 missense probably benign 0.31
R6823:Rarb UTSW 14 16443824 missense probably damaging 1.00
R6975:Rarb UTSW 14 16574942 missense possibly damaging 0.92
R7295:Rarb UTSW 14 16508932 critical splice donor site probably null
R7402:Rarb UTSW 14 16548419 missense probably damaging 1.00
R7849:Rarb UTSW 14 16548473 missense probably damaging 1.00
R7932:Rarb UTSW 14 16548473 missense probably damaging 1.00
X0065:Rarb UTSW 14 16434303 missense possibly damaging 0.89
Z1177:Rarb UTSW 14 16818725 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCCTCAGAAGATCCTAGAAGCC -3'
(R):5'- TTGAAAGCAGGAATCCGAGGTC -3'

Sequencing Primer
(F):5'- GATCCTAGAAGCCTCCAACTC -3'
(R):5'- TCCGAGGTCACTCCGAGAAAG -3'
Posted On2016-10-06