Incidental Mutation 'R5456:Trim13'
ID432768
Institutional Source Beutler Lab
Gene Symbol Trim13
Ensembl Gene ENSMUSG00000035235
Gene Nametripartite motif-containing 13
SynonymsLEU5, RNF77, Rfp2, 3110001L12Rik
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location61598247-61605946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61605074 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 180 (D180G)
Ref Sequence ENSEMBL: ENSMUSP00000128509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039562] [ENSMUST00000051184] [ENSMUST00000165015] [ENSMUST00000225582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039562
AA Change: D180G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045009
Gene: ENSMUSG00000035235
AA Change: D180G

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051184
SMART Domains Protein: ENSMUSP00000055327
Gene: ENSMUSG00000046168

DomainStartEndE-ValueType
BTB 5 106 8.7e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165015
AA Change: D180G

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128509
Gene: ENSMUSG00000035235
AA Change: D180G

DomainStartEndE-ValueType
RING 10 57 1.31e-8 SMART
BBOX 89 131 5.55e-12 SMART
transmembrane domain 316 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182259
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183066
Predicted Effect probably benign
Transcript: ENSMUST00000225582
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This gene is located on chromosome 13 within the minimal deletion region for B-cell chronic lymphocytic leukemia. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Tst T C 15: 78,399,958 E223G probably damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Trim13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Trim13 APN 14 61605670 missense probably benign
IGL00811:Trim13 APN 14 61604857 unclassified probably null
IGL01760:Trim13 APN 14 61605723 missense probably benign 0.06
IGL02411:Trim13 APN 14 61605149 missense probably damaging 1.00
IGL02625:Trim13 APN 14 61605550 missense probably benign 0.00
IGL02926:Trim13 APN 14 61605244 unclassified probably null
IGL03231:Trim13 APN 14 61605545 missense probably benign 0.11
R0089:Trim13 UTSW 14 61604717 missense possibly damaging 0.95
R0811:Trim13 UTSW 14 61605700 missense probably benign
R0812:Trim13 UTSW 14 61605700 missense probably benign
R1515:Trim13 UTSW 14 61605659 missense probably benign 0.03
R1778:Trim13 UTSW 14 61605619 missense probably benign 0.13
R2018:Trim13 UTSW 14 61604886 nonsense probably null
R2019:Trim13 UTSW 14 61604886 nonsense probably null
R4865:Trim13 UTSW 14 61605517 missense probably benign
R5860:Trim13 UTSW 14 61604739 missense probably damaging 0.96
R5921:Trim13 UTSW 14 61605089 missense probably benign 0.00
R7026:Trim13 UTSW 14 61605113 nonsense probably null
R7147:Trim13 UTSW 14 61604631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCTTCTGCGTAACTGATATGC -3'
(R):5'- AGCAATGTTGAAGGCCATCC -3'

Sequencing Primer
(F):5'- ATCTGTGCTACTCGAGGCG -3'
(R):5'- CGCTGCTCCTGTAAAATAGTG -3'
Posted On2016-10-06