Incidental Mutation 'R5456:Tst'
ID432769
Institutional Source Beutler Lab
Gene Symbol Tst
Ensembl Gene ENSMUSG00000044986
Gene Namethiosulfate sulfurtransferase, mitochondrial
SynonymsRhodanese
MMRRC Submission 043019-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5456 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location78399556-78405907 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78399958 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 223 (E223G)
Ref Sequence ENSEMBL: ENSMUSP00000055743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058659] [ENSMUST00000074380] [ENSMUST00000165170] [ENSMUST00000229878]
Predicted Effect probably damaging
Transcript: ENSMUST00000058659
AA Change: E223G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055743
Gene: ENSMUSG00000044986
AA Change: E223G

DomainStartEndE-ValueType
RHOD 11 140 2.88e-18 SMART
RHOD 163 285 1.48e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074380
SMART Domains Protein: ENSMUSP00000073984
Gene: ENSMUSG00000062154

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Pfam:TEX33 128 266 4.2e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165170
SMART Domains Protein: ENSMUSP00000133264
Gene: ENSMUSG00000062154

DomainStartEndE-ValueType
low complexity region 47 61 N/A INTRINSIC
low complexity region 63 71 N/A INTRINSIC
Pfam:TEX33 128 265 1.7e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229479
Predicted Effect probably benign
Transcript: ENSMUST00000229878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231525
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This is one of two neighboring genes encoding similar proteins that each contain two rhodanese domains. The encoded protein is localized to the mitochondria and catalyzes the conversion of thiosulfate and cyanide to thiocyanate and sulfite. In addition, the protein interacts with 5S ribosomal RNA and facilitates its import into the mitochondria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot12 A G 13: 91,741,640 D37G probably damaging Het
Adcy5 T C 16: 35,298,522 F1081S probably damaging Het
Apmap T A 2: 150,590,069 I128L probably benign Het
Arhgap12 G A 18: 6,112,170 Q65* probably null Het
Baat C T 4: 49,502,949 V58I possibly damaging Het
Bco2 T C 9: 50,545,344 probably null Het
Bend3 T C 10: 43,510,546 Y312H probably damaging Het
Btnl2 A T 17: 34,363,321 Y287F probably benign Het
Cd22 T C 7: 30,876,039 I193V probably benign Het
Commd3 A G 2: 18,674,157 E95G probably damaging Het
Dcbld1 A G 10: 52,314,390 D215G probably damaging Het
Elfn1 A G 5: 139,972,816 Y525C probably damaging Het
Fam83b T C 9: 76,492,595 T409A probably benign Het
Fshr T A 17: 88,986,348 I301F probably benign Het
Hemgn C T 4: 46,396,571 V222M probably damaging Het
Igsf3 C T 3: 101,427,221 H205Y probably benign Het
Mfsd1 T C 3: 67,589,833 I147T probably benign Het
Mslnl A G 17: 25,743,159 D177G probably damaging Het
Nat2 G A 8: 67,501,573 V112I probably damaging Het
Olfr1257 G A 2: 89,881,258 G144E probably damaging Het
Olfr284 G A 15: 98,340,365 A208V probably benign Het
Pabpc1l T C 2: 164,027,660 S127P probably damaging Het
Poln A T 5: 34,007,442 L845Q possibly damaging Het
Ppm1f T A 16: 16,923,746 D361E probably damaging Het
Rapgef5 T A 12: 117,728,646 probably null Het
Rarb G A 14: 16,436,843 T226I probably damaging Het
Sel1l3 T C 5: 53,200,036 K205E probably benign Het
Sh3glb1 T A 3: 144,709,353 I75L probably benign Het
Srgap1 G A 10: 121,869,811 S236L probably benign Het
Tmco3 A G 8: 13,319,815 Y609C probably damaging Het
Trhde A G 10: 114,486,760 V712A possibly damaging Het
Trim13 A G 14: 61,605,074 D180G possibly damaging Het
Umodl1 A G 17: 30,982,289 I397M probably benign Het
Usp31 T C 7: 121,670,277 D481G probably damaging Het
Vps13c T A 9: 67,927,447 M1686K possibly damaging Het
Wdr83 T C 8: 85,080,208 H81R probably benign Het
Other mutations in Tst
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Tst APN 15 78405461 missense probably damaging 1.00
IGL01457:Tst APN 15 78399767 missense probably benign 0.01
IGL01622:Tst APN 15 78399764 missense probably benign 0.06
IGL01623:Tst APN 15 78399764 missense probably benign 0.06
IGL03277:Tst APN 15 78405321 missense probably damaging 1.00
R0456:Tst UTSW 15 78405580 missense probably damaging 1.00
R1522:Tst UTSW 15 78399943 missense possibly damaging 0.67
R2518:Tst UTSW 15 78405833 start codon destroyed probably null 0.98
R7623:Tst UTSW 15 78405703 missense probably damaging 1.00
R7765:Tst UTSW 15 78405616 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- CTGAAGGGAACTGGCTGGATTG -3'
(R):5'- TTGACGATAAGCAGAGCCAGC -3'

Sequencing Primer
(F):5'- AGGAGGCTGCACACACTCAG -3'
(R):5'- CCAGCAAGAAATTGAGTTGCC -3'
Posted On2016-10-06