Incidental Mutation 'R0479:Ddx60'
ID 43279
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DExD/H box helicase 60
Synonyms DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
MMRRC Submission 038679-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.199) question?
Stock # R0479 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 8
Chromosomal Location 62381121-62490735 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 62422691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Tryptophan at position 643 (G643W)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect probably damaging
Transcript: ENSMUST00000070631
AA Change: G642W

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: G642W

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000093485
AA Change: G643W

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: G643W

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Meta Mutation Damage Score 0.3071 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency 98% (105/107)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ackr1 A G 1: 173,159,712 (GRCm39) V269A probably benign Het
Acsl1 G A 8: 46,984,109 (GRCm39) G543R probably damaging Het
Adam18 T C 8: 25,141,838 (GRCm39) N244D probably benign Het
Adgra3 C T 5: 50,147,607 (GRCm39) V478M probably benign Het
Arhgap39 C T 15: 76,619,086 (GRCm39) D833N probably damaging Het
Arhgef10 A T 8: 15,041,070 (GRCm39) E723V probably damaging Het
Arid3a C A 10: 79,787,128 (GRCm39) N519K possibly damaging Het
Atrn T A 2: 130,841,085 (GRCm39) Y1162* probably null Het
Cacng5 T A 11: 107,768,777 (GRCm39) N172Y probably benign Het
Cct8 C T 16: 87,284,594 (GRCm39) V198M probably damaging Het
Cep192 G A 18: 67,991,089 (GRCm39) S1857N probably damaging Het
Cherp A T 8: 73,216,991 (GRCm39) D657E possibly damaging Het
Clca3a2 T G 3: 144,796,610 (GRCm39) D199A probably damaging Het
Cops7b A G 1: 86,532,798 (GRCm39) T219A probably benign Het
Crb1 C T 1: 139,126,352 (GRCm39) M1392I probably damaging Het
Csf3r A C 4: 125,937,616 (GRCm39) E833D probably damaging Het
Cutc A G 19: 43,756,655 (GRCm39) E247G probably damaging Het
Cyp2c38 A G 19: 39,451,449 (GRCm39) L17P probably damaging Het
D5Ertd615e T A 5: 45,320,796 (GRCm39) noncoding transcript Het
Depdc1a C T 3: 159,226,497 (GRCm39) T268I probably damaging Het
Dgke T C 11: 88,943,296 (GRCm39) E231G probably benign Het
Dhrs7b T A 11: 60,746,513 (GRCm39) probably benign Het
Dll3 A G 7: 28,000,974 (GRCm39) V27A probably damaging Het
Dnmt3c T A 2: 153,556,861 (GRCm39) probably null Het
Duox1 T C 2: 122,176,861 (GRCm39) F1461L probably damaging Het
Enpep A G 3: 129,106,323 (GRCm39) V301A possibly damaging Het
Eny2 T A 15: 44,299,000 (GRCm39) probably null Het
Esr1 A G 10: 4,947,911 (GRCm39) D488G probably damaging Het
Ets1 A G 9: 32,641,476 (GRCm39) K110E probably damaging Het
Eya2 T A 2: 165,557,876 (GRCm39) Y157* probably null Het
F830045P16Rik T G 2: 129,314,608 (GRCm39) D223A possibly damaging Het
Fbh1 A G 2: 11,763,230 (GRCm39) Y475H probably damaging Het
Fbxo39 T C 11: 72,208,419 (GRCm39) I257T probably damaging Het
Fkbp10 T C 11: 100,306,740 (GRCm39) V23A probably damaging Het
Foxp3 A G X: 7,453,583 (GRCm39) I128V possibly damaging Het
Fzd7 T C 1: 59,522,867 (GRCm39) F250S probably damaging Het
Gaa A G 11: 119,172,062 (GRCm39) T722A possibly damaging Het
Gemin5 A G 11: 58,030,377 (GRCm39) V816A probably benign Het
Glb1l3 T A 9: 26,740,389 (GRCm39) T314S probably benign Het
H2-Ab1 A G 17: 34,483,942 (GRCm39) E101G possibly damaging Het
Hydin A C 8: 111,325,720 (GRCm39) T4710P probably damaging Het
Ica1 C T 6: 8,754,627 (GRCm39) V48M probably damaging Het
Ica1 T C 6: 8,754,683 (GRCm39) Y29C probably damaging Het
Ints7 T A 1: 191,346,666 (GRCm39) probably null Het
Iqub T C 6: 24,505,809 (GRCm39) E33G probably benign Het
Itgb1bp2 T A X: 100,492,806 (GRCm39) C10S probably damaging Het
Katnip T C 7: 125,442,518 (GRCm39) L809S probably benign Het
Kcnd1 T A X: 7,697,461 (GRCm39) I391N possibly damaging Het
Kdm8 T C 7: 125,051,812 (GRCm39) L135P probably damaging Het
Ksr1 T C 11: 78,916,109 (GRCm39) D574G probably damaging Het
Lama5 C T 2: 179,826,250 (GRCm39) R2331H probably benign Het
Larp1 C A 11: 57,933,646 (GRCm39) N357K possibly damaging Het
Lgi3 C T 14: 70,771,992 (GRCm39) probably benign Het
Lmbrd1 T A 1: 24,785,878 (GRCm39) probably benign Het
Methig1 A T 15: 100,272,825 (GRCm39) K53* probably null Het
Mfap3 T A 11: 57,420,469 (GRCm39) I150N probably damaging Het
Mug1 A T 6: 121,817,186 (GRCm39) Q85L probably benign Het
Npl A G 1: 153,391,155 (GRCm39) V200A probably damaging Het
Nuf2 A T 1: 169,326,503 (GRCm39) probably benign Het
Obscn A G 11: 59,003,533 (GRCm39) V1255A probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or5h18 C T 16: 58,847,491 (GRCm39) V260M possibly damaging Het
Or8b51 T C 9: 38,569,478 (GRCm39) D70G probably damaging Het
P2rx1 T C 11: 72,903,787 (GRCm39) V283A probably damaging Het
Pex2 C A 3: 5,626,355 (GRCm39) L151F probably damaging Het
Pias1 A G 9: 62,800,400 (GRCm39) probably benign Het
Pmfbp1 A T 8: 110,257,105 (GRCm39) probably benign Het
Pogz A G 3: 94,783,947 (GRCm39) K545E possibly damaging Het
Ppp3cb T C 14: 20,553,309 (GRCm39) probably null Het
Prl G A 13: 27,248,911 (GRCm39) D189N probably damaging Het
Prpf6 A G 2: 181,292,920 (GRCm39) N794S probably benign Het
Prr36 G A 8: 4,263,930 (GRCm39) Q579* probably null Het
Ptprq A T 10: 107,479,855 (GRCm39) Y1138* probably null Het
Rabepk A T 2: 34,675,592 (GRCm39) H179Q probably damaging Het
Rest T C 5: 77,430,598 (GRCm39) S1006P probably damaging Het
Rimklb A C 6: 122,441,175 (GRCm39) probably benign Het
Rnpepl1 T C 1: 92,846,587 (GRCm39) probably benign Het
Ro60 A T 1: 143,633,489 (GRCm39) D536E possibly damaging Het
Sacs T A 14: 61,428,928 (GRCm39) L329Q probably damaging Het
Safb C T 17: 56,913,025 (GRCm39) R914C probably damaging Het
Setd5 A T 6: 113,091,994 (GRCm39) I272F probably damaging Het
Sgk1 G T 10: 21,872,209 (GRCm39) A262S probably benign Het
Skint2 G A 4: 112,481,238 (GRCm39) V34I possibly damaging Het
Skint5 G C 4: 113,512,869 (GRCm39) Q888E unknown Het
Slc4a3 T C 1: 75,528,472 (GRCm39) probably benign Het
Sox10 T C 15: 79,047,519 (GRCm39) E133G probably damaging Het
Spryd3 G A 15: 102,038,835 (GRCm39) R129* probably null Het
Stag1 T A 9: 100,810,144 (GRCm39) N782K probably benign Het
Stam T C 2: 14,122,306 (GRCm39) L132P probably damaging Het
Stard9 T A 2: 120,528,077 (GRCm39) S1445T probably damaging Het
Syt5 C T 7: 4,546,108 (GRCm39) R94Q probably benign Het
Tbc1d23 A T 16: 56,992,177 (GRCm39) H594Q probably damaging Het
Tecta T A 9: 42,249,235 (GRCm39) I1871F probably damaging Het
Tek A G 4: 94,692,549 (GRCm39) D219G probably benign Het
Thrb T C 14: 18,033,643 (GRCm38) F469L probably damaging Het
Tyr T C 7: 87,142,429 (GRCm39) S44G possibly damaging Het
Usp20 T A 2: 30,907,487 (GRCm39) V673E probably benign Het
Usp28 T C 9: 48,948,513 (GRCm39) S873P probably damaging Het
Usp43 C T 11: 67,788,100 (GRCm39) V306M possibly damaging Het
Wdr17 G T 8: 55,104,456 (GRCm39) probably null Het
Wsb2 T G 5: 117,514,744 (GRCm39) probably benign Het
Xkrx A T X: 133,051,715 (GRCm39) L312Q probably damaging Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 62,411,680 (GRCm39) missense probably damaging 1.00
IGL00915:Ddx60 APN 8 62,440,465 (GRCm39) missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 62,422,617 (GRCm39) missense probably benign 0.18
IGL01023:Ddx60 APN 8 62,395,548 (GRCm39) missense probably damaging 0.99
IGL01313:Ddx60 APN 8 62,435,560 (GRCm39) missense probably damaging 1.00
IGL01615:Ddx60 APN 8 62,416,774 (GRCm39) missense probably null 0.81
IGL01733:Ddx60 APN 8 62,436,899 (GRCm39) missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62,470,857 (GRCm39) missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62,453,743 (GRCm39) splice site probably benign
IGL02110:Ddx60 APN 8 62,470,281 (GRCm39) critical splice donor site probably null
IGL02302:Ddx60 APN 8 62,428,866 (GRCm39) missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 62,411,676 (GRCm39) missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62,477,985 (GRCm39) missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 62,395,470 (GRCm39) splice site probably null
IGL02657:Ddx60 APN 8 62,437,149 (GRCm39) missense probably benign 0.01
IGL02677:Ddx60 APN 8 62,441,166 (GRCm39) missense probably damaging 1.00
IGL02701:Ddx60 APN 8 62,432,375 (GRCm39) missense probably damaging 0.96
IGL02806:Ddx60 APN 8 62,409,156 (GRCm39) missense probably benign 0.00
IGL03137:Ddx60 APN 8 62,441,117 (GRCm39) missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 62,409,155 (GRCm39) missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62,465,483 (GRCm39) missense probably damaging 1.00
IGL03411:Ddx60 APN 8 62,430,916 (GRCm39) critical splice acceptor site probably null
Scatter UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
shotgun UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
splay UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 62,411,147 (GRCm39) missense probably benign
PIT4677001:Ddx60 UTSW 8 62,425,288 (GRCm39) missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 62,395,327 (GRCm39) missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62,486,527 (GRCm39) missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 62,436,889 (GRCm39) missense probably benign 0.00
R0367:Ddx60 UTSW 8 62,470,783 (GRCm39) missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 62,447,575 (GRCm39) splice site probably benign
R0561:Ddx60 UTSW 8 62,470,828 (GRCm39) missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 62,440,395 (GRCm39) missense probably benign 0.27
R1119:Ddx60 UTSW 8 62,395,578 (GRCm39) missense probably damaging 1.00
R1428:Ddx60 UTSW 8 62,411,193 (GRCm39) splice site probably benign
R1778:Ddx60 UTSW 8 62,427,210 (GRCm39) missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 62,422,587 (GRCm39) missense probably damaging 0.99
R1964:Ddx60 UTSW 8 62,401,903 (GRCm39) missense probably benign 0.10
R1970:Ddx60 UTSW 8 62,425,240 (GRCm39) missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 62,393,679 (GRCm39) missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62,470,234 (GRCm39) missense probably benign 0.01
R2174:Ddx60 UTSW 8 62,409,175 (GRCm39) missense probably damaging 1.00
R2198:Ddx60 UTSW 8 62,411,097 (GRCm39) missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62,490,125 (GRCm39) missense probably benign 0.08
R2338:Ddx60 UTSW 8 62,465,470 (GRCm39) missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62,490,122 (GRCm39) missense probably damaging 1.00
R4010:Ddx60 UTSW 8 62,409,178 (GRCm39) missense probably benign 0.25
R4010:Ddx60 UTSW 8 62,407,569 (GRCm39) missense possibly damaging 0.65
R4133:Ddx60 UTSW 8 62,425,254 (GRCm39) missense probably damaging 0.99
R4282:Ddx60 UTSW 8 62,447,427 (GRCm39) missense probably damaging 0.99
R4382:Ddx60 UTSW 8 62,402,012 (GRCm39) splice site probably null
R4561:Ddx60 UTSW 8 62,395,495 (GRCm39) missense probably damaging 0.96
R4572:Ddx60 UTSW 8 62,440,455 (GRCm39) missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62,476,295 (GRCm39) missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62,490,101 (GRCm39) missense probably benign 0.28
R4698:Ddx60 UTSW 8 62,465,458 (GRCm39) missense probably benign 0.01
R4807:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62,474,348 (GRCm39) missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 62,432,372 (GRCm39) missense probably damaging 1.00
R5120:Ddx60 UTSW 8 62,398,940 (GRCm39) missense probably benign 0.01
R5187:Ddx60 UTSW 8 62,427,222 (GRCm39) missense probably damaging 1.00
R5222:Ddx60 UTSW 8 62,437,192 (GRCm39) missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62,463,036 (GRCm39) missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 62,403,485 (GRCm39) missense probably benign 0.28
R5514:Ddx60 UTSW 8 62,411,091 (GRCm39) missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62,453,612 (GRCm39) missense probably benign 0.38
R5742:Ddx60 UTSW 8 62,401,955 (GRCm39) missense probably benign
R5772:Ddx60 UTSW 8 62,401,931 (GRCm39) missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62,465,422 (GRCm39) nonsense probably null
R5815:Ddx60 UTSW 8 62,416,756 (GRCm39) missense probably damaging 0.98
R5820:Ddx60 UTSW 8 62,409,155 (GRCm39) missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 62,393,774 (GRCm39) missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62,474,444 (GRCm39) critical splice donor site probably null
R6048:Ddx60 UTSW 8 62,453,616 (GRCm39) missense probably benign 0.01
R6061:Ddx60 UTSW 8 62,476,275 (GRCm39) missense probably null 0.01
R6153:Ddx60 UTSW 8 62,398,974 (GRCm39) missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 62,403,612 (GRCm39) missense probably damaging 1.00
R6415:Ddx60 UTSW 8 62,436,939 (GRCm39) missense probably benign 0.00
R6416:Ddx60 UTSW 8 62,451,715 (GRCm39) missense probably benign
R6416:Ddx60 UTSW 8 62,430,984 (GRCm39) missense probably benign 0.00
R6660:Ddx60 UTSW 8 62,409,273 (GRCm39) missense probably benign 0.00
R6694:Ddx60 UTSW 8 62,490,104 (GRCm39) missense probably damaging 1.00
R6715:Ddx60 UTSW 8 62,436,924 (GRCm39) missense probably benign 0.03
R6720:Ddx60 UTSW 8 62,453,723 (GRCm39) missense probably benign 0.10
R6937:Ddx60 UTSW 8 62,490,103 (GRCm39) missense probably damaging 1.00
R7153:Ddx60 UTSW 8 62,441,142 (GRCm39) missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R7409:Ddx60 UTSW 8 62,411,612 (GRCm39) missense probably benign 0.24
R7464:Ddx60 UTSW 8 62,393,708 (GRCm39) missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 62,428,826 (GRCm39) missense probably damaging 1.00
R7904:Ddx60 UTSW 8 62,430,924 (GRCm39) missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 62,407,569 (GRCm39) missense probably benign 0.03
R8124:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8125:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8126:Ddx60 UTSW 8 62,436,945 (GRCm39) missense probably benign
R8155:Ddx60 UTSW 8 62,470,205 (GRCm39) missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62,470,284 (GRCm39) splice site probably null
R8192:Ddx60 UTSW 8 62,431,002 (GRCm39) missense probably damaging 1.00
R8271:Ddx60 UTSW 8 62,393,142 (GRCm39) critical splice donor site probably null
R8301:Ddx60 UTSW 8 62,453,631 (GRCm39) missense probably benign 0.01
R8304:Ddx60 UTSW 8 62,451,803 (GRCm39) missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 62,395,669 (GRCm39) critical splice donor site probably null
R8374:Ddx60 UTSW 8 62,427,205 (GRCm39) missense probably benign 0.01
R8401:Ddx60 UTSW 8 62,409,277 (GRCm39) missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 62,427,184 (GRCm39) missense probably damaging 1.00
R8804:Ddx60 UTSW 8 62,411,640 (GRCm39) missense probably benign 0.27
R8826:Ddx60 UTSW 8 62,398,990 (GRCm39) missense probably benign 0.02
R8829:Ddx60 UTSW 8 62,393,695 (GRCm39) missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62,474,343 (GRCm39) missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 62,447,553 (GRCm39) missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 62,427,168 (GRCm39) nonsense probably null
R9122:Ddx60 UTSW 8 62,442,898 (GRCm39) missense probably benign 0.16
R9225:Ddx60 UTSW 8 62,470,875 (GRCm39) missense probably benign 0.36
R9278:Ddx60 UTSW 8 62,431,012 (GRCm39) missense possibly damaging 0.83
R9293:Ddx60 UTSW 8 62,462,994 (GRCm39) missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 62,425,248 (GRCm39) missense probably benign 0.03
R9766:Ddx60 UTSW 8 62,465,312 (GRCm39) missense probably damaging 1.00
X0003:Ddx60 UTSW 8 62,486,451 (GRCm39) missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 62,416,726 (GRCm39) missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62,453,622 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTTCCGTTTGGGCAGGAGACCA -3'
(R):5'- GCTGTTGGCCTCCTCATGGAGATT -3'

Sequencing Primer
(F):5'- GCAGGAGACCAAGGCTG -3'
(R):5'- CGCATCTCTATGAACTCTCCAGTC -3'
Posted On 2013-05-23